Dinapsis tricolor Shaw & van Noort, 2022

van Noort, Simon, Shaw, Scott Richard & Copeland, Robert S., 2022, Revision of the endemic African genus Dinapsis (Dinapsini, Megalyridae, Hymenoptera) with description of seven new species, ZooKeys 1112, pp. 27-122 : 27

Dinapsis tricolor Shaw & van Noort sp. nov.

Figs 27 , 28 , 29 , 30 , 31 , 32

Material examined.

Holotype. South Africa • ♀; KwaZulu-Natal , Louwsberg, Sanyati Farm; 1090 m a.s.l.; 27°34'S, 31°17.9'E; 30 Oct.-18 Dec. 2005; Malaise trap (MTR); M. Mostovski leg.; NMSA-HYM 002030; NMSA . Paratypes. South Africa • 2 ♀♀; same data as holotype NMSA-HYM 000547; NMSA-HYM 000548; NMSA • 2 ♀♀; La Mercy, site 1; 85 m a.s.l.; 29°37'41.0"S, 31°06'45.4"E; yellow pan trap; M. Mostovski leg.; NMSA-HYM 000545; NMSA-HYM 000546; NMSA • 1 ♂; Eshowe, nr. Ntumeni N.R.; 680 m a.s.l.; 28°52'08"S, 31°22'41"E; 20 Apr.-26 Oct. 2007; Malaise trap; Kolyada and Mostovski leg.; NMSA-HYM 000544; NMSA • 2 ♀♀; KwaZulu-Natal, Ndumo Game Reserve; [26.881013°S, 32.252109°E]; 7-8 Nov. 2002; C. Desjardins leg.; yellow pan trap; USNM. KENYA • 1 ♀; Eastern prov. Marsabit Forest; 1380 m a.s.l.; 2.32031°N, 37.98595°E; Malaise trap; indigenous forest; near campsite; 16-30 Nov. 2015; R. Copeland; ICIPE 49121; ICIPE • 1 ♀; Coast Province , Mrima Hill Forest ; 212 m a.s.l.; 4.48576°S, 39.25845°E; Malaise trap; edge of indigenous forest; 25 Dec. 2011 - 8 Jan. 2012; ICIPE 49122; R. Copeland leg.; ICIPE; • 1 ♀; Eastern Province , Njuki-ini Forest ; Malaise trap; 17-31 Jul. 2006; ICIPE 49123; R. Copeland leg.; ICIPE • 1 ♀; same data except 17-30 Jan. 2007; ICIPE 49124; UWIM • 1 ♂; Eastern Province , Njuki-ini Forest near Forest Station ; 1455 m a.s.l.; 0.51660°S, 37.41843°E; Malaise trap; just inside indigenous forest; 14-28 Aug. 2007; R. Copeland leg.; ICIPE 49125; ICIPE • 1♂; Eastern Province , Njuki-ini Forest near Forest Station ; 1471 m a.s.l.; 0.51663°S, 37.41852°E; Malaise trap; just inside indigenous forest; 21 Jul.-4 Aug. 2008; R. Copeland leg.; ICIPE 2140; ICIPE • 1 ♀; Coast Province , Shimba Hills, Longomwagandi Forest ; 389 m a.s.l.; 4.23456°S, 39.41687°E; 27 Aug.-10 Sep. 2008; Malaise trap; R. Copeland leg.; ICIPE 49126; ICIPE • 1 ♂; same data except 23 Oct. -5 Nov. 2008; ICIPE 2828; ICIPE • 1 ♀; Nyanza Province , Gwasi Hill, near top; 29 Jul.-12 Aug. 2005; R.S. Copeland leg.; ICIPE 49127; ICIPE • 1 ♀; Coast Prov. , Buda Forest ; 98m a.s.l.; 4.46109°S, 39.40446°E; Malaise trap in indigenous forest; 22 Apr. -6 May 2016; ICIPE 49128; ICIPE • 1 ♂; same data except 6-20 May 2016; 4056-66; ICIPE 10305; SAMC • 1 ♀; Coast Prov. , Muhaka Forest ; 54m; 4.32575°S, 39.52323°E; Yellow pan trap in indigenous forest; Apr.-July 2018; R. Copeland leg.; 0815-20; ICIPE 10306; ICIPE • 1 ♂; Coast Prov. , Taita Hills, Mwatate area ; 1011 m a.s.l.; 3.48444°S, 38.33251°E; Malaise trap below Bura Bluff; riverine forest; 7-21 Feb. 2012; R. Copeland leg.; ICIPE 49129; NMKE • 1 ♂; Coast Prov. , Kasigau Mtn.; indigenous forest; 1065 m a.s.l.; 3.82700°S, 38.64875°E; Malaise trap next to campsite in forest; 14-28 Dec. 2011; R. Copeland leg.; ICIPE 49130; ICIPE • 1 ♀; Eastern Prov. , Gai Hill, near base of; 959 m a.s.l.; 0.60992°S, 38.18894°E; Malaise trap; in indigenous forest; 7-21 Dec. 2021 R. Copeland leg.; ICIPE 49459; ICIPE .

Diagnosis.

Morphologically similar to D. taita , however, D. tricolor may be distinguished by the mesoscutum being coarsely foveate and usually entirely black (Figs 29C , 31A ). In the key to African Dinapsis species by Hedqvist (1967), D. tricolor keys to couplet 2 because of the presence of minute ocular setae, a characteristic shared with Dinapsis zulu , which also occurs in KwaZulu-Natal. Dinapsis tricolor is easily distinguished from Dinapsis zulu by the latter’s smaller body size, shorter erect setae dorsally on the head vertex and metanotum; temple and gena rugose, with two postocular carinae, and more compact metasoma. Females of D. tricolor have a distinctive tri-coloured antenna, with the scape, pedicel, and F1-F2 orange, F3-F4, F5 basally, and F8-F12 dark brown, and a pale brownish white flagellar band on F5 (apically), F6, and F7. Dinapsis oculohirta is a smaller species (females <3 mm), with more densely setose eyes, smooth vertex with a medial row of punctures between ocelli, two distinct postocular orbital carinae, smooth mesoscutal lobes, scutoscutellar sulcus demarcated by row of punctures, more pale forewing bands (not filling the marginal cell), and propodeum medially lacking transverse carinae between the submedian longitudinal carinae. In contrast, D. tricolor is a larger species (females 3.5-5.5 mm) with a coarsely foveate-reticulate vertex, the second postocular orbital carina either absent or irregular and indistinct, coarsely foveate-reticulate mesoscutal lobes, scutoscutellar sulcus demarcated by sulcus, dark forewing band completely filling the marginal cell, and propodeum medially with weakly developed transverse carinae between the submedian longitudinal carinae. Dinapsis oculohirta is only known to occur in Madagascar, while D. tricolor is only known from continental Africa. In colour and size, D. tricolor is somewhat similar to D. centralis Shaw & van Noort, which also occurs in Kenya. However, the mostly dark brown flagellum (lacking a strongly contrasting pale-coloured median band) of D. centralis easily distinguishes females of this species from D. tricolor , females of which have a pale yellowish white band on flagellomeres 6 and 7. Another curious and distinctive character of D. centralis is the presence, on the hind tibia and basistarsus, of large erect dorsal setae, some of which have expanded spatulate tips. The setae on D. tricolor are smaller and hair-like, lacking spatulate tips.

Distribution.

(Fig. 44 ) Kenya, South Africa (KwaZulu-Natal Province).

Comments.

Dinapsis tricolor is only known from forested localities in Kenya and South Africa but is likely to be present all along the East African coastal regions from Kenya to South Africa, a sub-biogeographical unit comprising similar faunal and floral assemblages throughout the region. All 14 Kenyan specimens of D. tricolor were collected in wet, canopy-forest habitats. Four of the sites are small relict coastal forests (Mrima Hill, Muhaka, Buda, and Longomwagandi forest in the Shimba Hills National Park). The latter is under the jurisdiction of the Kenya Wildlife Service while the others are the responsibility of the Kenya Forest Service. Mrima, Muhaka and Buda are also kayas, sacred forests where cultural and religious activities are still held. As such they also receive a measure of protection from encroachment through the overview of local elders. Kasigau mountain forms, along with the nearby Taita Hills, the northernmost extension of the eastern arc mountains, a chain of ancient non-volcanic crystalline mountains centred mostly in Tanzania. Dinapsis tricolor was also collected in riverine forest at the base of the Taita Hills. This species was also found in the Kenyan highlands in Njuki-ini forest, once continuous with the great forests of Mount Kenya but now cut off because of population pressures. The Gwasi hills site is on the edge of Lake Victoria in western Kenya. The forests on the upper side and the top of the hill have been largely destroyed as a result of agricultural expansion. Finally, Marsabit mountain in northern Kenya is essentially a desert mountain, but as the only geological feature of any great elevation in the xeric north, any moisture that accompanies easterly winds tends to precipitate out over the mountain. Additional water comes from the frequent mists that cover the entire mountain and descend to the forest floor at certain times of the year. Within Kenya, then, D. tricolor has by far the widest geographic distribution of Dinapsis species, found from Taita Hills in the south to Marsabit Mountain in the north, and from the Kenyan coast in the east to the shores of Lake Victoria in the west. Its altitudinal distribution is also great, with specimens collected from near sea level to 1471 m (Njuki-ini Forest) and ca. 1500 m in the western Gwasi hills.

Etymology.

Dinapsis tricolor is named for its distinctive tri-coloured antennae (Fig. 27C ). Noun in apposition.

Barcode sequence for paratype specimens ICIPE 49121.

specimen code: 38754_A07_ NMKE_Din_tric (sequence code in BOLD:FSA1899-21) BIN URI: None (sequence too short).

Nucleotide sequence for ICIPE 49121.

AATAGAATTAAGAGTCCCAGGTTCTTTTATTGGTAATGATCAAATTTATAATTCTATTGTGACTGCTCNTGCTTTTATTATAATTTTTTTTATAGTTATACCATTTATAATGGGGGGATTTGGAAATTGACTTCTTCCCTTAATATTAGGAGCTCCGGATATATCTTATCCTCGTCTAAATAATCTGAGATTTTGATTATTAATTCCTTCTTTAATATTTTTATTAATAAGATTTTATATTGGTAGAGGAACAGGAACAGGATGAACTAT.

Barcode sequence for paratype specimen NMSA-HYM-000546.

specimen code: 38754_A08_NMSA-HYM-000546 (sequence code in BOLD: FSA1900-21) BIN URI: None (sequence too short).

Nucleotide sequence for NMSA-HYM-000546.

TCTTTAAGATTATTAATTCGAGCTGAATTAGGAAGTCCAGGATCTTTAATTGGGGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGGGGGTTTGGAAATTGATTAGTACCCCTAATATTAGGGGCCCCTGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGACTTTTACCACCCTCTATTACTCTCTTAATCTCCAGAAGAATCGTAGAAAATGGGGCTGGAAC.

Description.

Holotype female. Body length 4.5 mm excluding ovipositor.

Colour. Body mostly black to dark brown with sparse minute white setae. Antenna distinctively tri-coloured, with scape, pedicel, and F1-F2 orange; F3-F4, F5 basally, and F8-F12 dark brown; and pale brownish white flagellar band on F5 apically, all of F6, and F7. Mandible, wing venation, metasomal sternites, hypopygium apically, ovipositor and sheath dark red-brown. Fore and mid femora and tibiae red-brown to bright orange. Trochanters, trochantellus and coxae (except hind coxae which are dark brown to black basally), white, orange or yellow. Hind femur and tibia black to dark red-brown, apices may be orange-brown. Eyes and ocelli silvery. Wing membrane clear except two dark brown pigmented bands across forewing.

Head round, 1.11 × wider than height; vertex, frons, and face evenly foveate-reticulate; ocelli small, OOL 1.80 × ocellar diameter; ocellar triangle equilateral; eye large and slightly protuberant, nearly parallel in anterior view; eye evenly covered with distinct ocular setae; eye margined posteriorly by coarsely foveate groove and two distinct postocular orbital carinae; antenna with 12 flagellomeres having flagellar length/width ratios as follows: F1 = 5.0, F2 = 4.0, F3 = 3.5, F10 = 2.5, F11 = 2.5, F12 (apical flagellomere) = 3.75; apical flagellomere not wider than basal flagellomeres; temple areolate-reticulate, temple width 1.25 × eye width in lateral view; gena areolate-reticulate medially and ventrally; malar space length 1.0 × mandible width basally; border of occipital carina coarsely foveate.

Mesosoma. Pronotum punctate and finely setose medio-laterally, except laterally with coarsely foveate median depression and posteriorly with evenly foveate margin; mesoscutum as wide as long, mesoscutal lobes coarsely foveate, with sparse punctures and scattered erect setae, anterolateral corners lacking tubercles; median mesoscutal sulcus and scutoscutellar sulci finely and evenly foveate; transscutal articulation narrow, finely foveate; scutellar disc medially smooth and shining, with scattered punctures laterally; scutellar disc medially devoid of setae, laterally rimmed with small erect setae, and posteriorly with shorter, denser, depressed setae; axillae smooth with scattered punctures and sparse small erect setae; mesopleuron mostly rugo-punctate and evenly setose, anterior border foveate, disc with large median mid-pit, and distinctly depressed ventro-medially to conform to meso-femur shape; propodeum medially with weakly-developed transverse carinae between longitudinal carinae, submedian longitudinal carinae posteriorly diverging slightly towards middle of propodeum.

Legs. Apex of fore tibia with comb of eight stout spines; hind coxa smooth to finely shagreened, weakly covered with long, silky, white setae not obscuring surface; hind femur stout, 2.2 × longer than wide, outer surface of hind femur sparsely but evenly covered with long, erect, silky white setae, inner surface of femur smooth, shining, and mostly devoid of setae; surface of hind tibia smooth, tibia dorsally, laterally, and ventrally with long, silky white setae, dorsal setae longer and black but hair-like, lacking spatulate tips; inner median margin of hind tibia with a dense longitudinal patch of shorter white setae; hind basitarsus long, distinctly longer than remaining four tarsomeres combined; basitarsus ventrally with dense preening brush consisting of numerous short, white setae, inclined posteriorly; basitarsus dorsally with normal hair-like setae, lacking spatulate tips; T2, T3, and T4 each shorter than preceding tarsomere, with T4 being the shortest; T2 ca. 1.5 × longer than T3, and ca. 2 × longer than T4; T2-T5 with short normal hair-like setae; T4 short and compact, length equal to width; tarsal claw simple, strongly curved.

Wings. Forewing length 3.0 mm; wing covered with scattered setae, less densely setose basally, more densely and evenly setose apically; wing clear with two vertical darkly pigmented bands. Basal wing band narrowest, starting at basal corner of cell 1M, extending ventrally to cover most of cell 2CU and 3A; apical wing band wider, starting at base of pterostigma, densely covering entire marginal cell 2R1, extending apically well beyond marginal cell and diffusely approaching wing apex, ventrally covering entire cell 1+2RS, with pigmentation extending across cells 2+3M and 3CU, to lower wing margin; forewing venation with vein Rs apically curving abruptly towards anterior wing margin to form very short, truncate marginal cell 2R1; apical segment of vein M long, extending slightly beyond apex of marginal cell, vein M with small white bulla situated at mid length of vein. Hind wing with apical stub of vein Rs very short, equal to ½ shortest width between the propodeal submedian longitudinal carinae basally.

Metasoma in dorsal view 2.9 × longer than wide, with seven dorsally visible terga, all smooth and shining dorsally, finely shagreened laterally; exposed portion of ovipositor, in lateral view, 1.62 × longer than metasoma length; ovipositor sheaths minutely setose, strongly curled (an artefact of preservation), appearing much shorter than ovipositor due to post-mortem curling.

Variation in paratype females.

Body length 3.4-5.5 mm. Forewing length 2.5-4.6.0 mm. Colour of F2 varies from dark brown to orange. Apical ½ to ¾ of F5 white. Ovipositor length varying from 1.6-2.0 × metasoma length. The ovipositor sheaths are normally as long as the ovipositor but may appear more or less much shorter due to post-mortem curling; however, one specimen has short sheaths that are < ¼ the ovipositor length (possibly a developmental abnormality, or as a result of damage). The Gai Hill specimen has more brightly coloured legs than the rest of the type series: fore leg coxa and trochanter very bright yellow, rest of leg bright orange; mid leg coxa orange/brown, trochanter bright yellow, rest of leg bright orange; hind leg coxa bright yellow except basally black, trochanter bright yellow, femur and tibia dark brown except the very apex of each orange/brown, tarsi light orange.

Variation in paratype males.

Body length 3.0-3.6 mm. Forewing length 2.4-2.6 mm. Antenna either entirely black, or with scape, pedicel, and F1-F2 dark brown, remainder of flagellomeres black without white band on F6-F7. Hind coxa mostly white, but black basally, or completely dark brown.

Figures

Figure 27. Dinapsis tricolor Shaw & van Noort, sp. nov. holotype female (NMSA) A habitus, lateral view B habitus, dorsal view C head, mesosoma, lateral view D head, mesosoma, dorsal view E metasoma, legs, lateral view F habitus, ventral view. Scale bars: 1000 µm (A, B, F); 500 µm (C-E).

Figure 28. Dinapsis tricolor Shaw & van Noort, sp. nov. holotype female (NMSA) A head, anterior view B head, dorsal view C head, anteroventral view D metasoma, dorsal view E hind leg, antiaxial view F wings, dorsal view (inset: data labels). Scale bars: 200 µm (A-C, E); 500 µm (D, F).

Figure 29. Dinapsis tricolor Shaw & van Noort, sp. nov. holotype female, SEM (NMSA) A head, mesosoma, lateral view B mesosoma, lateral view C mid and hind legs, lateral view D ovipositor terminal valves, lateral view.

Figure 30. Dinapsis tricolor Shaw & van Noort, sp. nov. paratype female, Kenya ICIPE 49121 (ICIPE) A habitus, dorsal view B habitus, lateral view C head, mesosoma, dorsal view D head, mesosoma, lateral view. E head, anterior view F head, dorsal view. Scale bars: 2000 µm (A, B); 500 µm (C, D); 200 µm (E, F).

Figure 31. Dinapsis tricolor Shaw & van Noort, sp. nov. paratype female, Kenya ICIPE 49121 (ICIPE) A mesosoma, dorsal view B mesosoma, lateral view C metasoma, dorsal view D metasoma, lateral view E hind and mid legs, antiaxial view F wings, dorsal view (inset: data labels). Scale bars: 200 µm (A, B); 500 µm (C-F).

Figure 32. Dinapsis tricolor Shaw & van Noort, sp. nov. paratype male, Kenya ICIPE 49129 (NMKE) A habitus, dorsal view B head, mesosoma, lateral view C mesosoma, dorsal view D head, dorsal view E head, anterior view F wings, dorsal view (inset: data labels). Scale bars: 500 µm (A, F); 200 µm (B, C, E); 100 µm (D).

Figure 44. Distribution map of Dinapsis species occurring on the African mainland (specimen point data plotted on a topographical relief map).