Dinapsis zulu Shaw & van Noort, 2022

van Noort, Simon, Shaw, Scott Richard & Copeland, Robert S., 2022, Revision of the endemic African genus Dinapsis (Dinapsini, Megalyridae, Hymenoptera) with description of seven new species, ZooKeys 1112, pp. 27-122 : 27

Dinapsis zulu Shaw & van Noort sp. nov.

Figs 39 , 40 , 41 , 42

Material examined.

Holotype. South Africa • ♀; KwaZulu-Natal, PMB, Karkloof , 1325 m a.s.l., 29°19.1'S, 30°15.5'E, 22 Jan.-6 Feb. 2007; YPT (yellow pan trap); Kolyada & Mostovski leg.; NMSA-HYM002031; NMSA . Paratypes. South Africa • 7 ♀♀ 1 ♂; same data as holotype; NMSA-HYM000536 to 543; NMSA • 1 ♂; same data as holotype, except for 22 Sep.-3 Oct. 2005; M. Mostovski leg.; NMSA-HYM000535; NMSA • 1 ♀; Cathedral Peak N.R., Rainbow Gorge ; 1480 m a.s.l.; 28°57.60'S, 29°13.61'E; 22 Sep.-17 Nov. 2006; MT [Malaise trap]; M. Mostovski leg.; NMSA • 1 ♀; Karkloof [29.297268°S, 30.231318°E]; 48 km NE Pietermaritzburg; mist forest; 27 Nov.-11 Dec. 1991; A. Mitchell leg.; Malaise trap; NMSA • 2 ♂♂; Eastern Cape, Katberg [32.473670°S, 26.670881°E]; 4,000 ft a.s.l.; 1-15 Jan. 1933; R.E. Turner leg.; Brit. Mus. 1933-1979; Dinapsis oculohirta species group, det. Scott R. Shaw 2015; NHMUK010370333; NHMUK010370327; NHMUK • 4 ♀♀ 1 ♂; Cape Province, Tsitsikama Coastal N.P.; 34°02'S, 23°53'E; Jan. 1996; Malaise trap; Michael Söderlund leg.; MZLU • 1 ♀; Cape Province, Tsitsikamma National Park ; 34°02'S, 23°53'E; 14-18 Dec 1994; loc. 23; R. Danielsson leg.; MZLU .

Diagnosis.

In the key to African Dinapsis species by Hedqvist (1967), D. zulu keys to couplet 2 because of the presence of minute ocular setae, a characteristic shared with Dinapsis oculohirta Hedqvist and some new species treated in this paper. Dinapsis oculohirta is a much smaller species (females <3 mm) that is only known to occur in Madagascar, so should not be confused with this new species. More characters for D. oculohirta are discussed in the diagnosis section for D. tricolor from Kenya. Dinapsis zulu is easily distinguished from other Dinapsis species by its large body size, very tall and erect setae dorsally on the head vertex and metanotum (Figs 39C , 41A ) (shared only with D. gamka ), gena smooth and punctate (lacking rugose sculpture), only one postocular carina, and elongate metasoma. Females have a long ovipositor and a pale-coloured band on F6-F7. Dinapsis zulu can be distinguished from D. gamka by the head height being subequal to the mesosoma height (the head is 1.5 × taller than the mesosoma in D. gamka ), and D. zulu has a wider postocular furrow behind the eye (as in Fig. 41A ).

Distribution.

(Fig. 44 ) South Africa (Eastern Cape and KwaZulu-Natal provinces).

Comments.

Based on currently known data, Dinapsis zulu is associated with the forest biome, which is a naturally highly fragmented habitat in South Africa ( Lawes 1990, 2004; Eeley et al. 1999; Mucina and Geldenhuys 2006; Lawes et al. 2007; Deng et al. 2020), and hence the species distribution is likely to follow suit. The current distribution pattern is likely to be an artefact of under-sampling and we expect the species to be recorded from further forest localities in both provinces. While the main body colour is black to dark brown in most specimens, the specimens from Tsitsikamma have lighter tones ranging from reddish brown to yellowish brown. This might be due to different environmental conditions (the Tsitsikamma forest is more temperate) during their development, or they might be specimens that were collected soon after emergence before the cuticle had fully tanned and darkened.

Etymology.

Dinapsis zulu is named after the Zululand region encompassing the type locality and the Zulu people. Noun in apposition.

Barcode sequences for paratype specimen.

38754_A09_NMSA-HYM-000539 (sequence code in BOLD: FSA1901-21) BIN URI: None (sequence too short).

Nucleotide sequence.

GCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTTTTATAATGGGAGGTTTTGGAAATTGATTATTACCTTTAATATTAGGNGCNCCTGATATATCTTACCCCCGAATAAATAATTTAAGATTTTGATTATTA

Description.

Holotype female. Body length 6.8 mm excluding ovipositor.

Colour. Body mostly black to dark brown with sparse minute white setae. Scape, pedicel, F1-F5, mandible, most of legs, wing venation, metasomal sternites, hypopygium apically, ovipositor and sheath dark reddish brown. F6-F7, trochanters, and hind coxa apically pale yellowish white. Eyes and ocelli silvery. Wing membrane clear except two dark brown pigmented bands across forewing.

Head round, 1.11 × wider than height; vertex, frons, and face shallowly and evenly punctate; ocelli small, OOL 1.8 × ocellar diameter; ocellar triangle equilateral; eye large and slightly protuberant, nearly parallel in anterior view; eye lightly and evenly covered with minute ocular setae; eye margined posteriorly by irregular and shallowly foveate groove and one distinct postocular orbital carina; second postocular orbital carina entirely absent; antenna with 12 flagellomeres having flagellar length/width ratios as follows: F1 = 5.6, F2 = 6.6, F3 = 6.6, F10 = 4.0, F11 = 4.0, F12 = 3.25; apical flagellomere slightly wider than basal flagellomeres; temple punctate, temple width 1.3 × eye width in lateral view; gena punctate medially, smooth ventrally; malar space length 1.5 × mandible width basally; border of occipital carina evenly foveate.

Mesosoma. Pronotum smooth, except laterally with foveate median depression; mesoscutum as long as wide, mesoscutal lobes smooth, with sparse punctures and scattered tall setae, antero-lateral corners lacking tubercles; median mesoscutal sulcus and axillular grooves narrowly and evenly foveate; scutellar furrow narrow and smooth; scutellar disc medially smooth and shining, with scattered punctures laterally; scutellar disc medially devoid of setae, laterally rimmed with large erect setae, and posteriorly with shorter, denser, depressed setae; axillae smooth with scattered punctures and sparse large erect setae; mesopleuron mostly smooth and lightly setose, medially, anterior border foveate, disc with large median mid-pit, and strongly depressed ventro-medially to conform to meso-femur shape; propodeum medially with well-developed transverse carinae between longitudinal carinae, submedian longitudinal carinae diverging posteriorly towards middle of propodeum.

Legs. Apex of fore tibia with comb of eight stout spines; hind coxa smooth to finely shagreened, weakly covered with long, silky, white setae not obscuring surface; hind femur stout, 2.5 × longer than wide, outer surface of hind femur sparsely but evenly covered with long, erect, silky white setae, inner surface of femur smooth, shining, and mostly devoid of setae; surface of hind tibia smooth, tibia dorsally, laterally, and ventrally with long, silky white setae, dorsal setae longer and black but hair-like, lacking spatulate tips; inner median margin of hind tibia lacking a dense longitudinal patch of shorter white setae; hind basitarsus long, distinctly longer than remaining four tarsomeres combined; basitarsus ventrally with dense preening brush consisting of numerous short, white setae, inclined posteriorly; basitarsus dorsally with normal hair-like setae, lacking spatulate tips; T2 and T3 each short and compact, each ca. twice as long as wide; T2 and T3 with normal hair-like setae; T4 extremely short, distinctly shorter than wide; tarsal claw simple, strongly curved.

Wings. Forewing length 4.4 mm; wing covered with scattered setae, less densely setose basally, more densely and evenly setose apically; wing clear with two dark pigmented vertical bands. Basal wing band narrowest, starting at basal corner of cell 1M, extending ventrally to cover most of cell 2CU and 3A; apical wing band wider, starting at base of pterostigma, densely covering entire marginal cell 2R1, extending apically well beyond marginal cell and diffusely approaching wing apex, posteriorly covering entire cell 1+2RS, with pigmentation extending across cells 2+3M and 3CU, to lower wing margin; forewing venation with vein Rs apically curving abruptly towards anterior wing margin to form very short, truncate marginal cell 2R1; apical segment of vein M long, extending well beyond apex of marginal cell, vein M with small white bulla situated at mid length of vein. Hind wing with apical stub of vein Rs very short, equal to ½ shortest width between the propodeal submedian longitudinal carinae basally.

Metasoma in dorsal view 3.1 × longer than wide, with seven dorsally visible terga, all smooth and shining dorsally, finely shagreened laterally; exposed portion of ovipositor, in lateral view, 1.65 × longer than metasoma length; ovipositor sheaths minutely setose, strongly curled (an artefact of preservation), appearing much shorter than ovipositor due to post-mortem curling.

Variation in paratype females.

Body length 3.8-6.8 mm. Forewing length 3.0-4.4 mm. Pale band on F6-F7 varying from light yellowish white to light brown. Hind coxa varying from mostly dark brown or black to mostly yellowish white, but always dark brown to black basally and yellowish white apically. Ovipositor length varying from 1.6-2.0 × metasoma length. Head colour varying from black to reddish brown. Metasoma colour varying from black to light reddish or yellowish brown.

Variation in paratype male.

Body length 3.0 mm. Forewing length 2.4 mm. Antenna entirely dark brown, without a yellowish white band on F6-F7. Hind coxa entirely dark brown to black, lacking pale colour basally.

Figures

Figure 39. Dinapsis zulu Shaw & van Noort, sp. nov. holotype female (NMSA) A habitus, lateral view (inset: data labels) B habitus, dorsal view C head, mesosoma, lateral view D head, mesosoma, dorsal view E mesoscutellum, propodeum, dorsal view F habitus, ventral view. Scale bars: 1000 µm (A, B, F); 500 µm (C, D); 200 µm (E).

Figure 40. Dinapsis zulu Shaw & van Noort, sp. nov. holotype female (NMSA) A head, anterior view B head, dorsal view C head, mesoscutum, dorsal view D metasoma, dorsal view E metasoma, hind leg lateral view F wings, dorsal view. Scale bars: 200 µm (A-C); 500 µm (D-F).

Figure 41. Dinapsis zulu Shaw & van Noort, sp. nov. holotype female, SEM (NMSA) A head, mesonotum, pronotum, lateral view B mesosoma, lateral view C metasoma, lateral view.

Figure 42. Dinapsis zulu Shaw & van Noort, sp. nov. paratype male NHMUK 010370333 (NHMUK) A habitus, dorsal view B habitus, lateral view C head, mesosoma, dorsal view D head, mesosoma lateral view E head, anterior view F wings, dorsal view (inset: data labels). Scale bars: 1000 µm (A, B); 500 µm (C, D); 200 µm (E, F).

Figure 44. Distribution map of Dinapsis species occurring on the African mainland (specimen point data plotted on a topographical relief map).