Olidiana pakistanica, Naveed & Wang & Cao & Zhang, 2020
publication ID |
https://doi.org/ 10.11646/zootaxa.4778.2.11 |
DOI |
https://doi.org/10.5281/zenodo.3846643 |
persistent identifier |
https://treatment.plazi.org/id/8F2587A3-FFF3-FFA3-81E2-C464C9EFFD1E |
treatment provided by |
Plazi |
scientific name |
Olidiana pakistanica |
status |
sp. nov. |
Olidiana pakistanica View in CoL sp. nov. ( Figs. 1 View FIGURE 1 A–K)
Description. Male.
Length. Male: 7.2 mm.
Crown light brown with two black longitudinal patches on each side of coronal suture, eyes and ocelli gray; pronotum black with light brown granules, dense and pale fine hair-like setae; scutellum black with brown spots in posterior half; forewings piceous with various irregular pale markings; veins with pale spots. Face pale with frontoclypeal area, anteclypeus and lorum black.
Body medium-sized. Head narrower than pronotum, anterior margin narrowly rounded; crown produced beyond anterior margin of eye, distal length shorter than 1/3 of entire length, disc narrow, interocular width about equal to transocular width; lateral margin convergent basally; ocelli prominent near anterior margin of crown; eyes large, elongateovoid; pronotum about equal to crown length, scutellum large, median length prominent, greater than median length of pronotum. Wings and venation as in description of genus (as Lodiana ) by Nielson (1982). Clypeus long, lateral margins convex, surface finely granulose; clypellus elongate, lateral margins concave medially, apex expanded. Crown, pronotum and mesonotum midline ratio about 1: 1.16: 2.11.
Male genitalia. Pygofer with hair-like setae, in lateral aspect caudal margin slightly produced and converging caudally, apex enlarged without caudodorsal lobe, inner margin with tuft of strong long setae subapically; caudoventral process near base of pygofer, elongate to caudal apex, with several secondary strong teeth from base to median and some sharp teeth at apical third. Aedeagus slender, tubular, asymmetrical, apex incurved dorsally with small spines in lateral view; shaft with one subapical process on left, several secondary spines along outer margin; gonopore at middle of subapical process. Dorsal connective narrow and straight. Style small and short. Connective broad, with anterior arm short. Subgenital plate slender, lateral margins nearly parallel, outer margin with hair-like setae, apex rounded with small spines.
Female. General habitus same as male, but face pale with lateral margin of clypeus dark brown. Forewing with one rounded pale spot at distal end of Cu.
Material examined. Holotype ♂, Pakistan: Punjab, Murree Hills , 2291m, 26 Aug. 2017, coll. Hassan Naveed (Hm035196) . Paratypes: 8 ♂, 1 ♀ (Hm035198) same data as holotype .
Etymology. This new species is named after the country because this is the first species of Coelidiinae described from Pakistan.
Molecular characters. Partial mitochondrial gene COI sequence of Olidiana pakistanica sp. nov. was registered in
GenBank with accession number MH752800 View Materials ; the sequence is as follows:
>Coi_ Olidiana _pakistan
a a c a a t a t a t t t t t t a t t t g g a a t a t g a t c a g g a a t a a t a g g a a t a a t a t t a a g a a t a a t t a t t c g a a c t g a a c t t a c a c a a c c t g g a t c t t t c t - t a a a t a a t g a t c a t t t a t a t a a t g t t a t t g t a a c a t c t c a t g c t c t a a t t a t a a t t t t c t t t a t a g t t a t a c c t a t t a t a a t t g g a g g a t t c g g a a a t t g a t- tacttccaattataattggagcccctgatatagctttcccacgactaaataatataagattttgattacttccaccgtcaatcattatactaatttcaagatc attaattgactcaggtgtaggaacaggatgaacactatatccacctttatcatctaatatctctagagcaggaattagagtagatatttcaattttctcactgcacatagctg- gaatttcatcaatcttaggagcattaaatttcattacaacagtaatgaatatacgagcacctggaatattaatagataaaacaccattattcgtatgatcagtattaattactg- caatcctcttattaatttctttaccagtattagctggtgcaattactatactattaacagatcgaaatttaaatacaacattttttaatccagcaggagggggtgaccctattctatatcaacacttattt
Remarks. The new species is similar to Olidiana flavocostata Li & He , but can be distinguished by the pygofer with a strong and long caudoventral process basally, and the aedeagus with a process subapically. The latter species lacks the pygofer caudoventral process and the aedeagus has an apical process. The new species has a similar aedeagus to Olidiana opulenta , but its pygofer also lacks a strong and long caudoventral process. This new species keys to the latter species of Olidiana in the key to species from India, Myanmar, Nepal, Thailand and Vietnam by Nielson (2015).
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.