Discovery and Genetic Characterization of Single Cohort Adult Colonies With Male Aggregations, and Preliminary Evidence for Lekking in a Malagasy Kite Spider (Isoxya, Author Agnarsson, Ingi University of Iceland, Faculty of Life- and Environmental Sciences, Sturlugata 7, 102 Reykjavik, Iceland, iagnarsson@gmail.com Author Starrett, James Department of Entomology and Nematology, University of California, Davis, Davis, CA 95616, USA, Author Babbitz, Zachary Department of Chemistry, Boston College, 2609 Beacon Street, Chestnut Hill, MA, 02467, USA, Author Bond, Jason E. Department of Entomology and Nematology, University of California, Davis, Davis, CA 95616, USA, text Insect Systematics and Diversity 2023 2023-02-15 7 1 1 15 http://dx.doi.org/10.1093/isd/ixac029 journal article 10.1093/isd/ixac029 2399-3421 10833631 ISoxYa manangona sp. n. DNA depository GENBANK (MZ539942) Plates 1–3 , Figs. 2–25 Holotype : Male holotype deposited at the Smithsonian Institution’s National Museum of Natural History , collected by the authors in Toamasina province , Eastern Madagascar , along the road leading from Andasibe to Mantadia ( Andasibe-Mantadia National Park at −18.82663 , 48.43333 ), on 5–8. December 2017 . Paratypes : 2 female and 1 male paratypes deposited at the Smithsonian Institution’s National Museum of Natural History, and 2 female and 2 male paratypes deposited at the Oxford University Museum of Natural History, with locality and collection data as in holotype above. Other material: A total of 257 other conspecific individuals were collected (locality and collection data as above). These consisted of 161 mature females, 2 sub-adult females, 101 mature males and 1 sub-adult male. Etymology: The specific epithet is a noun in apposition and refers to the Malagasy verb ‘to gather/aggregate’, referring to the species unusual mating aggregations. Diagnosis: Females and males, where currently known, can easily be distinguished from the majority of Isoxya species except for I. cicatricosa , I. cowani , I. mahafalensis and I. reuteri by the general somatic appearance ( Figs. 2–4 and 9–11 ). Female I. manangona differ from the above four species: by the anterior dorsal edge of the abdomen not being prominently ridged like I. cowani on either side, not protruding from the center like I. mahafalensis and not immediately starting the base of the first pair of spines like in I. cicatricosa and I. reuteri ( Fig. 2 ), the external epigyne structure of Isoxya species often appear similar, however I. manangona differs from all four similar species by being more prominently arched; with the septum not being dimpled in the center like I. cicatricosa , I. cowani and I. reuteri ( Figs. 5–6 and 8 ); the tips of the epigyne in the posterior view being deeply V shaped in the center not shallow like I. cicatricosa , I. cowani and I. mahafalensis ; and the internal spermatheca being reniform and almost touching in the dorsal view ( Fig. 7 ) although, as with the external structures, these can appear similar in Isoxya species ; from I. cicatricosa , I. cowani and I. mahafalensis by the greater size of all three pairs of abdominal spines ( Figs. 2–4 ); and from I. cicatricosa , I. cowani and I. reuteri by the alignment of the second pair of abdominal spines ( Figs. 2 and 4 ). The female of the species I. mossamedensis , also similar in external morphology but only known from the dorsal illustration in Benoit (1962a) , and only found in Angola . Male I. manangona differ from I. cicatricosa , I. cowani and I. mahafalensis by the anterior dorsal edge of the abdomen not being prominently ridged like I. cowani , not protruding from the center like I. mahafalensis and not immediately starting the base of the first pair of spines like in I. cicatricosa ( Fig.9 ); and the greater size of all three pairs of abdominal spines compared to all three; from I. cowani by the alignment of the second pair of abdominal spines ( Figs. 9 and 11 ); and from I. cicatricosa and I. mahafalensis by the anterior tip of the median apophysis being thinner and conspicuously curved away from the dorsal of the palp, not almost straight like both species; tip of median apophysis not dimpled unlike I. cicatricosa ; ventral lateral edge being widely wedge-shaped in I. manangona not thin like both species or rounded in I. mahafalensis ( Figs. 14 and 17 ); and the shape of the embolus being elongated and smoothly hooked, not short and sharply hooked like the two species ( Figs. 12 and 15–16 ). It was not possible to check the palp of I. cowani as the type specimens in the NHM London had their palps removed and not returned to the tube. However, the female of I. cowani and the shape of the male abdomen are significantly different. The males of I. mossamedensis and I. reuteri are unknown. Plate 1. Figs. 2–8. Female: dorsal (Fig. 2), ventral (Fig. 3), side (Fig. 4); epigyne: ventral (Fig 5), posterior (Fig. 6), spermatheca dorsal (Fig. 7); line drawing: epigyne ventral (Fig. 8). Plate 2. Figs. 9–17. Male: dorsal (Fig. 9), ventral (Fig. 10), side (Fig. 11); palp: dorsal (Fig. 12), ventral (Fig. 13), retrolateral (Fig. 14), prolateral (Fig. 15); line drawings:dorsal palp (Fig. 16), median apophysis (Fig. 17). Description of female: The female I. manangona has a dark grey to black carapace and cephalothorax with thin white hairs irregularly across the dorsal surface. The eight eyes are arranged with the PME and AME in a trapezium in the center and the PLE and ALE joined at the edge of the carapace. The chelicerae are black. The abdomen is heavily sclerotized and possesses three pairs of clearly developed spines with the second pair almost vertical to the abdomen and the third pair horizontal with the abdomen. All six spines taper to a point and are jet-black from the base to the tip on the dorsal side but become lighter on the ventral and external sides ( Figs. 2–4 ). There are 26 conspicuous large sigillae on the dorsal side of the abdomen ( Fig. 2 ) (10 anterior edge, 4 median arranged in a trapezium, 2 in the ‘ Isoxya ’ position for sigilla number 6 ( Emerit 1974 ), and 10 on the posterior edge - with the central posterior pair becoming almost fused together), and 32 sigillae on the ventral side ( Fig. 3 ); many being obscured by the wrinkles on the ventral side and many hidden by the legs when in natural pose. There are some irregular small sigillae on the dorsal side, but these are not recorded as typically the prominent large sigillae on the dorsal side of the abdomen are used to aid identification ( Emerit 1974 ). The dorsal side of the abdomen possesses cryptic yellow markings over a black to dark grey. These markings are variable (see Variation and Figs. 18–21 ) but usually include spots at the base of the spines, the center anterior edge of the abdomen and the line of bilateral symmetry. A smooth parabolic arch connects the two posterior spines with a yellow dot on the center of this arch ( Fig. 2 ). There are sporadic thin white hairs on the dorsal side of the abdomen. The ventral side of the abdomen is the same background color as the dorsal side, with many small yellow spots of color across the wrinkled ridges that transverse from the side of the abdomen towards the spinnerets, and a large focus of yellow spots around the area surrounding the base of each spine. The spinnerets are surrounded by a sclerotized shield shape, a sclerotized spiracle is also present ( Fig. 3 ). The sternum is the same color as the cephalothorax with five radial pale yellow dashes around the posterior of the sternum. The anterior of the sternum also fades into this same pale yellow forming a semicircle of bright color. The maxillae and labium are black, fading to a pale brown nearing the tips of each structure. The tarsi on the legs are black with the remaining segments becoming dark grey to dark brown. There are small yellow or light brown bands at the joints of each of the legs. Epigynum is a heavily sclerotized double arch, or rounded M shape in the ventral view ( Figs. 5 and 8 ) and a deep V in the arch in the posterior view ( Fig. 6 ), with a very short, flat septum with rounded edges ( Figs. 5 and 6 ) less sclerotized than the rest of the epigyne. This is often membranous in young females (see Variation ). Spermathecae reniform and almost touching at base ( Fig. 7 ). Plate 3. Figs. 18–25. Female:melanic dorsal (Fig.18), ventral (Fig.19); light dorsal (Fig.20), ventral (Fig. 21); Male: melanic dorsal (Fig.22), ventral (Fig. 23); light dorsal (Fig. 24), ventral (Fig. 25). Fig. 26. Clustering of individuals from the nine web colonies (A–I) based on discriminant analysis of principal components from unlinked SNPs. Female measurements (general measurements are taken from female paratype A, leg measurements from female paratype B, no spine measurements are included in the measurements): TL 5.11. CL 1.28, CW 2.3. PME 0.1 wide, 0.07 long. AME 0.11 wide, 0.145 long. PLE 0.123 long, 0.096 wide. ALE 0.142 long, 0.143 wide. AL 3.69, AW 5.6. SL 1.38, SW 1.0. Leg I: 6.54 total, (0.79 + 0.32 + 1.66 + 0.94 + 1.12 + 0.97 + 0.74), Leg II 6.28 total (0.65 + 0.37 + 1.68 + 0.86 + 1.15 + 0.88 + 0.69), Leg III 4.39 total (0.47 + 0.26 + 1.19 + 0.57 + 0.62 + 0.67 + 0.61), Leg IV 6.6 total (0.71 + 0.40 + 1.88 + 0.77 + 1.01 + 1.1 + 0.73). Description of male: The male I. manangona has a black carapace with thin white hairs in a thick I shape on the dorsal surface and the same eye structure as the female. The chelicerae are black. The abdomen possesses three pairs of clearly developed spines with the second pair almost vertical to the abdomen. All six spines are jet-black from the base to the tip and taper to a point. There are 26 conspicuous large sigillae on the dorsal side of the abdomen ( Fig. 9 ) (10 anterior edge, 4 median arranged in a trapezium, 2 in the ‘ Isoxya ’ position for sigilla number 6 ( Emerit 1974 ), and 10 on the posterior edge - with the central posterior pair becoming almost fused together), and 28 sigillae on the ventral side ( Fig. 10 ); like the female they are mostly obscured by the wrinkles on the ventral side and the legs when in a natural pose. Like with the female, the additional smaller sigillae are not recorded. The dorsal side of the male abdomen is the same color as the female abdomen, but without the conspicuous yellow markings. A beige spot is found centered on the anterior edge of the abdomen, between the first pair of spines. A second, smaller, spot is in the center of the parabolic arch which connects the third pair of spines. The dorsal, ventral, and sides of the abdomen possess thin white hairs, with the densest patches on the dorsal center of the abdomen and the sides ( Figs. 9 and 11 ). The ventral side of the abdomen is the same dark color as the dorsal side but the ventral side is more monochromatic in color than that of the female. Spinnerets are as listed in the female description. The sternum of the male is like the female but lacks the bright conspicuous markings, only faint lighter markings are present. The maxillae and labium are the same, consistently darker than the female. The legs of the male are darker than the female with faint lighter bands nearing the joints of each leg. The male palp is heavily sclerotized, typical of the Isoxya palps ( Figs. 12–15 ). The embolus has a pronounced pars pendula ( Figs. 12 and 14–16 ). The embolus is smoothly hooked in shape and the embolic terminus possesses a slight double-pointed dimple visible when viewed in the retrolateral plane ( Fig. 14 ). The median apophysis is heavily sclerotized with an extended curved posterior tip and a wedge shape on the open lateral side forming an internal outline of a fishing-hook ( Figs. 14 and 17 ). The paracymbium is heavily sclerotized and forms a short hook ( Figs. 12–14 ). Fig. 27. Membership probability for each individual to the nine web colonies (A–I) based on the discriminant analysis of principal components clustering from unlinked SNPs. Male measurements (general measurements are taken from the holotype , leg measurements are taken from male paratype A, no spine measurements are included in the measurements): Total length 4.32. CL 1.0, CW 1.79. PME 0.1 wide, 0.091 long. AME 0.145 wide, 0.072 long. PLE 0.072 long, 0.087 wide. ALE 0.064 long, 0.073 wide. AL 3.12, AW 4.91. SL 1.09, SW 0.78. Leg I 5.19 total (0.54 + 0.29 + 1.33 + 0.68 + 0.95 + 0.85 + 0.55), Leg II 4.97 total (0. 6 + 0.24 + 1.34 + 0.7 + 0.8 + 0.74 + 0.55), Leg III 3.4 total (0.45 + 0.21 + 0.92 + 0.44 + 0.42 + 0.49 + 0.47), Leg IV 4.84 total (0.53 + 0.27 + 1.41 + 0.54 + 0.72 + 0.82 + 0.55). DNA Barcode: Genbank (MZ539942). Sequence starts at base 25 of the standard DNA Barcode ------------------------ttgagctgctatagtaggaacggctataagagttttaattcgta ttgaacttgggcaacctggtaggttcattggggatgatcagttatataatgtggtggtaactgct catgcatttgtaataattttttttatagtaataccgattttgattggagggtttgggaattgattagt tccattaatactaggtgctcctgatatagcttttcctcgaataaataatttaaggttttgacttctcc ccccttcgttatttcttttagaaatttcgtcaatagtagagataggagtaggagcaggatgaact gtttatccccctctagctgggctagaagggcatgctgggagatctgtggattttgctattttttctctt catttggctggggcttcttctattatgggagccattaattttatttctacaatcattaatatacggttt tatggaatgactatagaaaaagttcctttatttgtatgatcagtcttaattactgcggttttattatta ttatctcttccagtattggctggtgctattacaatattattaacagatcgaaattttaatacttcatttt ttgatccttctgggggtggggaccctattttgtttcaacatttattt Variation: Freshly molted males and females are lighter in color with more conspicuous yellow markings on both dorsal and ventral sides ( Figs. 20–21 and 24–25 ), as the abdomen and female genitalia are not yet fully sclerotized, and the hairs around the maxillae, labium, sternum, dorsal and ventral side of the abdomen, legs and cephalothorax are denser and more vibrant. The older females are of the more typical color form with less hairs and a more worn appearance. The angle of the second pair of spines is also related to the apparent age of the specimen; the younger, fresher molted females having a more vertical angle as opposed to the older, recently fed, or gravid females. Confirming Emerit’s (1974) observations, we collected melanic males and females ( Figs. 18–19 and 22–23 ) in several colonies of I. manangona . The extreme ends of color variation, melanic and lighter, are shown in both male and female specimens ( Figs. 18–25 ) and the typical form ( Figs. 2–4 and 9–11 ). The females ranged from 4.8mm- 6.1mm TL and the males 3.9mm- 4.5mm TL (all TL measurements exclude posterior spines). Fig. 28. Unsupervised machine learning clustering analysis based on unlinked SNPs using variational autoencoders. Colors for individuals are based on the web colony (A–I) from which they were collected. Distribution: Currently known only from the type locality in eastern Madagascar . Natural History: Males were seen to remain in the web when disturbed during collecting, unlike the Gasteracantha males from Madagascar who drop to the floor according to Emerit (1974) ‘Les mâles et les nymphes femelles, jusqu’à la troisième incluse, se laissent toujours tomber dès qu’on touche à leur toile’. In colony A, a partially wrapped and eaten Isoxya sp . was collected. This could not be identified to species, but it was confirmed to not be a specimen of I. manangona due to a clearly different sigillae pattern on the dorsal side. Other Gasteracanthinae were seen and collected around the area of the I. manangona colonies.