Leurus wahli Zuñiga & Valerio, 2024

Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Smith, M. Alex, Hallwachs, Winnie & Janzen, Daniel H., 2024, Cryptic diversity of Leurus wasps (Hymenoptera: Ichneumonidae: Metopiinae), parasitoids of caterpillars in Area de Conservación Guanacaste, Costa Rica, Zootaxa 5529 (3), pp. 511-531 : 529-530

publication ID	https://doi.org/ 10.11646/zootaxa.5529.3.5
publication LSID	lsid:zoobank.org:pub:09787995-E3D5-4FB7-AB9F-AFB46371B02B
DOI	https://doi.org/10.5281/zenodo.14034666
persistent identifier	https://treatment.plazi.org/id/572E8790-0F0D-A70B-95FE-552B1374FE2F
treatment provided by	Plazi
scientific name	Leurus wahli Zuñiga & Valerio
status	sp. nov.

Treatment

Leurus wahli Zuñiga & Valerio , sp. nov.

( Figs. 6 View FIGURES5–9 , 14 View FIGURES 14–19 , 20 View FIGURES 20–25 )

Diagnostic description. Female. Fore wing length 5.5–5.6 mm (holotype 5.4 mm). Malar space 1.0–1.1 × basal mandibular width; antenna with 24–25 flagellomeres, all except first and last segment transverse (wider than long). Genitalia: setae on ovipositor sheaths extending basally for a distance equal to or less than 0.3x the total length, setae constrained to ventral edge, sparse, setae thin and elongated; lower-anterior extension of quadrate plate elongated and thin, somewhat lobate at tip, setae on ventral edge of quadrate plate thin, normally large. Coloration. Scape yellow and brown; pedicel dark brown; flagellum dark brown to black. Tegula entirely yellow. Metasoma with metallic blue iridescence. Trochanters mostly light brown, front femur with basal 2/3 black and apical 1/3 yellow, mid femur similar but only extreme apex yellow, hind femur all black; front tibia yellow, mid and hind tibiae with basal half yellow and apical half black; fore tarsus pale yellow with last 3 segments more orangish, mid tarsus pale yellow with last 3 segments light brown, hind tarsus with first 2–3 segments mostly pale with dark apicies, last 2–3 segments all dark.

Male. Similar to female in size and color; scape often entirely yellow. Antenna with 26–30 flagellomeres. Genitalia: digitus completely lobate at base; volsella medial area deep, volsella tip (in lateral view) mainly rounded but somewhat flat; phallus apex slender, phallus constriction elongate; overall shape of phallus based on the width difference between the phallus apex and the phallus width: somewhat thin, straight looking; distal third of gonoforceps normally setose, setae somewhat sparse.

Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0014018 . 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste , Costa Rica, 04-SRNP-45922. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Cacao , Estación Gongora , 10.88700, -85.47443, 570m (Mariano Pereira), caterpillar feeding on Paspalum nutans ( Poaceae ) coll. 14.vi.2004 wasp eclosed 23.vi.2004 GoogleMaps . Paratypes. 10 ♀, 2 ♂, ( EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 10-SRNP-30927: DHJPAR0039538 (♂); 10-SRNP-31119: DHJPAR0039542 (♀); 10-SRNP-31091: DHJPAR0039543 (♀); 04-SRNP-45845: DHJPAR0028066 (♀); 04-SRNP-45874:DHJPAR0028067 (♀); 04-SRNP-45919:DHJPAR0029447 (♀); 04-SRNP-45894: DHJPAR0028068 (♀); 04-SRNP-45876:DHJPAR0014019 (♀); 10- SRNP-41191: DHJPAR0039547 (♀); 04-SRNP-45899: DHJPAR0028070 (♀); 04-SRNP-45895: DHJPAR0028069 (♂); 09-SRNP-5377: DHJPAR0038423 (♀); 12-SRNP-55938: DHJPAR0050005 (♀).

Barcode. DNA barcode of female holotype DHJPAR0014018 (660 bp):

ATTTTATACTTCATTTTTGGAATTTGAGCAGGAATAATTGGTGCTTCACTTAGTATTATTATCCGT ATAGAATTAGGAACCCCCAGTTCCTTAATTAATAATGATCAAATTTATAATTCTATTGTCACTATACATGCCTTT ATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACTTATTCCTTTAATATTAGG AGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGATTCTGATTGTTACCCCCATCCTTATTTTTATTAA TTTCTGGTAGAATATTAAATCAAGGTGCAGGTACTGGTTGAACAGTTTACCCTCCTTTATCTTCTAATACAAATC ATGAAGGATTATCAGTTGATTTAAGAATTTTCTCTCTTCATTTAGCTGGTATATCTTCAATTATAGGTGCAATT AATTTTATTACAACAATTTTAAATATAAAAATTAAATTATTAACTTTAGATCAACTTTCATTATTTATTTGATCC ATTAAAATTACTACTATTTTACTTTTACTAGCAGTCCCTGTTTTAGCAGGAGCAATTACCATATTATTAACTG ACCGTAACTTAAATACCTCTTTTTTTGACCCTAGAGGAGGAGGGGATCCAATTTTATACCAACATTTATTTN

Etymology. This species is named in honor of David B. Wahl, formerly curator of the American Entomology Institute (Gainesville, Florida), presently curator at Utah State University, in recognition of his decades of study of ichneumonid systematics.

Comments. Leurus wahli is the only species having the combination of metallic blue metasoma and a completely yellow tegula. It is also the only Leurus encountered to date parasitizing a grass-feeding caterpillar.

Hosts. Leurus wahli has been reared 15 times from a sample of 440 caterpillars of the rain forest Herpetogramma phaeopteralis (Guenée) ( Crambidae ) feeding on three species of Poaceae ( Table 1 View TABLE 1 ).