A new species of Clavicornaltica (Coleoptera: Chrysomelidae), discovered and described on a field course to Kuala Belalong, Brunei
Schilthuizen, Menno
Berenyi, Alfie E. A.
Limin, Army
Brahim, Aqilah
Cicuzza, Daniele
Eales, Anthony J.
Escoubas, Pierre
Grafe, Ulmar
de Groot, Michiel D.
Hayden, William C.
Paterno, Marta
Jambul, Rafi'ah
Slik, J. W. Ferry
Ting Teck Wah, Dennis
Tucker, Angela
Njunjic, Iva
Biodiversity Data Journal
2019
7
32555
32555
urn:lsid:zoobank.org:act:4CB0D18A-009F-4C91-801A-69435B8F7542
Schilthuizen et al., 2019
Schilthuizen et al.
2019
Insecta
Chrysomelidae
Clavicornaltica
GBIF
Animalia
Clavicornaltica belalongensis
Coleoptera
0
32555
Arthropoda
species
belalongensis
Materials Type status: Holotype. Occurrence: recordedBy: Taxon Expeditions field course participants; individualCount: 1; sex: female; lifeStage: adult; preparations: card-mounted; disposition: in collection; Taxon: scientificName: Clavicornalticabelalongensis; kingdom: Animalia; phylum: Arthropoda; class: Hexapoda; order: Coleoptera; family: Chrysomelidae; taxonRank: species; scientificNameAuthorship: Schilthuizen et al., 2019; nomenclaturalCode: ICZN; Location: locationID: TxExBr0004w; continent: Asia; island: Borneo; country: Brunei Darussalam; stateProvince: Temburong; locality: Kuala Belalong Field Studies Centre; verbatimLocality: Ulu Temburong, near Kuala Belalong Field Studies Centre, along Ashton Trail; verbatimElevation: 120; decimalLatitude: 4.5472; decimalLongitude: 115.1571; Identification: identificationID: UBDM.3.01171; Event: samplingProtocol: Winkler sampling; samplingEffort: 150 l of forest leaf litter; eventDate: 2018-09-27; habitat: Lowland dipterocarp forest; Record Level: type: PhysicalObject; bibliographicCitation: Clavicornalticabelalongensis (UBDM.3.01171); institutionID: UBD; institutionCode: IBER-UBD; collectionCode: Zoology; basisOfRecord: PreservedSpecimen Type status: Paratype. Occurrence: recordedBy: Taxon Expeditions field course participants; individualID: TxExBr0004w-2; individualCount: 1; sex: female; lifeStage: adult; preparations: card-mounted; disposition: in collection; Taxon: scientificName: Clavicornalticabelalongensis; kingdom: Animalia; phylum: Arthropoda; class: Hexapoda; order: Coleoptera; family: Chrysomelidae; genus: Clavicornaltica; specificEpithet: belalongensis; taxonRank: species; scientificNameAuthorship: Schilthuizen et al., 2019; nomenclaturalCode: ICZN; Location: locationID: TxExBr0004w; continent: Asia; island: Borneo; country: Brunei Darussalam; stateProvince: Temburong; locality: Kuala Belalong Field Studies Centre; verbatimLocality: Kuala Belalong Field Studies Centre, along Ashton trail; verbatimElevation: 120 m; verbatimLatitude: 4.5472; verbatimLongitude: 115.1571; Event: samplingProtocol: Winkler sampling; samplingEffort: 150 l of forest leaf litter; eventDate: 2018-09-27; habitat: Lowland dipterocarp forest; Record Level: type: PhysicalObject; bibliographicCitation: Clavicornalticabelalongensis (UBDM.3.01172); institutionID: UBD; institutionCode: IBER-UBD; collectionCode: Zoology; basisOfRecord: PreservedSpecimen Type status: Paratype. Occurrence: recordedBy: Taxon Expeditions field course participants; individualID: TxExBr0014w-3; individualCount: 1; sex: female; lifeStage: adult; preparations: card-mounted; disposition: in collection; Taxon: scientificName: Clavicornalticabelalongensis; kingdom: Animalia; phylum: Arthropoda; class: Hexapoda; order: Coleoptera; family: Chrysomelidae; genus: Clavicornaltica; specificEpithet: belalongensis; taxonRank: species; scientificNameAuthorship: Schilthuizen et al., 2019; nomenclaturalCode: ICZN; Location: locationID: TxExBr0014w-3; continent: Asia; island: Borneo; country: Brunei Darussalam; stateProvince: Temburong; locality: Kuala Belalong Field Studies Centre; verbatimLocality: Kuala Belalong Field Studies Centre, along Ashton trail; verbatimElevation: 120 m; decimalLatitude: 4.5472; decimalLongitude: 115.1571; Event: samplingProtocol: Winkler sampling; samplingEffort: 150 l of forest leaf litter; eventDate: 2018-09-27; habitat: Lowland dipterocarp forest; Record Level: type: PhysicalObject; bibliographicCitation: Clavicornalticabelalongensis (UBDM.3.01173); institutionID: UBD; institutionCode: IBER-UBD; collectionCode: Zoology; basisOfRecord: PreservedSpecimen Type status: Paratype. Occurrence: recordedBy: Taxon Expeditions field course participants; individualID: TxExBr0004w-4; individualCount: 1; sex: female; lifeStage: adult; preparations: card-mounted; disposition: in collection; Taxon: scientificName: Clavicornalticabelalongensis; kingdom: Animalia; phylum: Arthropoda; class: Hexapoda; order: Coleoptera; family: Chrysomelidae; genus: Clavicornaltica; specificEpithet: belalongensis; taxonRank: species; scientificNameAuthorship: Schilthuizen et al., 2019; nomenclaturalCode: ICZN; Location: locationID: TxExBr0004w; continent: Asia; island: Borneo; country: Brunei Darussalam; stateProvince: Temburong; locality: Kuala Belalong Field Studies Centre; verbatimLocality: Kuala Belalong Field Studies Centre, along Ashton trail; verbatimElevation: 120 m; decimalLatitude: 4.5472; decimalLongitude: 115.1571; Event: samplingProtocol: Winkler sampling; samplingEffort: 150 l of forest leaf litter; eventDate: 2018-09-27; habitat: Lowland dipterocarp forest; Record Level: type: PhysicalObject; bibliographicCitation: Clavicornalticabelalongensis (UBDM.3.01174); institutionID: UBD; institutionCode: IBER-UBD; collectionCode: Zoology; basisOfRecord: PreservedSpecimen Type status: Paratype. Occurrence: recordedBy: Taxon Expeditions field course participants; individualID: TxExBr0004w-5; individualCount: 1; sex: female; lifeStage: adult; preparations: card-mounted; disposition: in collection; Taxon: scientificName: Clavicornalticabelalongensis; kingdom: Animalia; phylum: Arthropoda; class: Hexapoda; order: Coleoptera; family: Chrysomelidae; genus: Clavicornaltica; specificEpithet: belalongensis; taxonRank: species; scientificNameAuthorship: Schilthuizen et al., 2019; nomenclaturalCode: ICZN; Location: locationID: TxExBr0004w; continent: Asia; island: Borneo; country: Brunei Darussalam; stateProvince: Temburong; locality: Kuala Belalong Field Studies Centre; verbatimLocality: Kuala Belalong Field Studies Centre, along Ashton trail; verbatimElevation: 120 m; decimalLatitude: 4.5472; decimalLongitude: 115.157; Event: samplingProtocol: Winkler sampling; samplingEffort: 150 l of forest leaf litter; eventDate: 2018-09-27; habitat: Lowland dipterocarp forest; Record Level: type: PhysicalObject; bibliographicCitation: Clavicornalticabelalongensis (UBDM.3.01176); institutionID: UBD; institutionCode: IBER-UBD; collectionCode: Zoology; basisOfRecord: PreservedSpecimen Type status: Paratype. Occurrence: recordedBy: Taxon Expeditions field course participants; individualID: TxExBr0004w-8; individualCount: 1; sex: female; lifeStage: adult; preparations: card-mounted; disposition: in collection; Taxon: scientificName: Clavicornalticabelalongensis; kingdom: Animalia; phylum: Arthropoda; class: Hexapoda; order: Coleoptera; family: Chrysomelidae; genus: Clavicornaltica; specificEpithet: belalongensis; taxonRank: species; scientificNameAuthorship: Schilthuizen et al., 2019; nomenclaturalCode: ICZN; Location: locationID: TxExBr0004w; continent: Asia; island: Borneo; country: Brunei Darussalam; stateProvince: Temburong; locality: Kuala Belalong Field Studies Centre; verbatimLocality: Kuala Belalong Field Studies Centre, along Ashton trail; verbatimElevation: 120 m; decimalLatitude: 4.5472; decimalLongitude: 115.1571; Event: samplingProtocol: Winkler sampling; samplingEffort: 150 l of forest leaf litter; eventDate: 2018-10-01; habitat: Lowland dipterocarp forest; Record Level: type: PhysicalObject; bibliographicCitation: Clavicornalticabelalongensis (UBDM.3.01175); institutionID: UBD; institutionCode: IBER-UBD; collectionCode: Zoology; basisOfRecord: PreservedSpecimen
Description Body orange-red, small, nearly hemispherical, 1.15-1.30 mm long and 0.9-1.1 mm wide (i.e. ca. 1.25 times as long as wide) (Fig. 2). Elytra with punctate rows, deeply impressed along their entire length. Spermathecal receptacle pear-shaped and distinctly separated from the pump. Female wingless. Male unknown. Head (Fig. 3): Rectangular, ca. 0.35 mm wide (measured across the eyes), densely beset with confluent double punctuation; tubercles and midfrontal sulcus poorly developed and inconspicuous. Eyes convex, each eye consisting of 26-30 ommatidia, ca. 1/5 the width of the head measured across the eyes in dorsal view. Antennae: clava long and moderately robust. Pronotum: Very weakly shagreened and punctuated; punctures sparse and minute, of similar strength to the subordinate punctuation on the elytra; pronotal surface therefore shiny. Lateral margin with a callosity that stretches from the anterior to the posterior corner. Lateral setiferous pore at 2/3 of the length of the margin, seta as long as the clava of the antenna, pore removed from the margin by a distance similar to the width of antennomere II. Posterior setiferous pore placed directly at the margin, the seta length similar to antennomeres IX+X. Hind wings: Absent. Elytra: Shiny, punctate in 9 longitudinal rows, scutellar row 1/4the length of the other rows, consisting of ca. 6 punctures. Punctures in all rows deeply impressed along their entire length (puncture width is similar to their interspaces). In between, the major punctures are irregularly scattered and there are much smaller subordinate punctures. A rudiment of a 10th row exists in the final 1/3 flanking the elytral margin. A fine groove runs along the entire margin continuing to the apex; apex itself slightly drawn out. The internal edge of epipleura carries a short row of punctures, alongside the 4th and 5th visible sternite. Legs: Tibia and tarsus orange, femur dark orange and robust. Metafemur robust, oval, covered in reticulate microsculpture. External edge of metatibia bearing two parallel rows of 8-10 minute stiff setae placed along the terminal one-fifth and flanking the basis of metatarsomere I. Internal side of metatibia bearing ca. 10 thin setae that are placed along the terminal half of the tibia and increase to about 2.5 xthe length of the external setae, then decrease in length towards the apex. The metatibia carries a long terminal spine of about the same length as metatarsomere I. No serrations or microteeth are visible on the spine. Mesosternum: Processus rounded, with a distinct margin, central area somewhat convex. Abdomen: Carina on the first visible abdominal sternite sharp and narrow, not broadened anteriorly or posteriorly, running along the length of the sternite. In reduced form, this carina is carried on to the four posterior sternites, which therefore, in lateral view, offer a slightly serrated aspect. The surface of the sternites carries a rough microsculpture of confluent punctures. Tergum IX (last visible tergite) with three longitudinal median ridges, the central one of which is much weaker than the two outermost. Subapically, tergum IX has a horizontal row of 8 serrations. Female genitalia: Spermatheca consisting of a pear-shaped receptacle, ca. 90 µmin length, with crosswise annulations (Fig. 4a.) The strongly bent pump is 1/3 the width of the receptacle, attached to the widest part of the receptacle and distinctly separated from it. Duct as long as the pump. Tignum long (0.5 mm) and narrow (10 µm). Vaginal palpi fused basally, long (300 µm) and narrow (max. 10 µm), terminally provided with two long, externally pointing setae (Fig. 4b). DNA barcode: 5'GACTTTCCCTTAGTATATTAATCCGAATCGAATTAAGAAATCCAAGATCATTTATTTCTAATATTCATTTATATAATGTTTTAGTAACAATACATGCTTTTATTATAATTTTTTTTATAATTATACCAATTATAATTGGAGGATTCGGAAATTGATTAATCCCACTAATAATTGGGGCCCCTGATATAGCCTTCCCACGTATAAATAACCTAAGATTCTGATTTTTACCTCCTTCTATAATCTTATTAATTCTTAGTATATTTAGTGAAATAGGAGCAGGAAGAGGATGAACCCTTTATCCCCCATTATCAAATACTTTCTTCCATAATGGACCCGCTATTGACCTAACTATTTTTAGTCTTCATTTAGCTGGAATCTCATCAATCCTTGGAGCAATAAACTTTATTTCTACAATAATTAATATAAAAATTTATAAATTAAAATTTGATCAAATAACCCTCTTTTCTTGAGCTTCCCTTATTACAACTATTCTATTACTATTAGCTTTACCTGTATTAGCAGGAGCTATCACTATACTACTTACAGATCGTAATCTTAATACTTCTTTTTTTGATCCCTCAGGAGGAGGAGACCCCCTATTATAT3' (holotype, UBDM.3.01171; BOLD accession TXEX004-18)
Diagnosis The most important diagnostic features in which Clavicornaltica belalongensissp. n. differs from all other known Clavicornalticaare (i) the pear-shaped spermathecal receptacle that is distinctly separated from the pump and (ii) the medially keeled abdominal sternites. Furthermore, the new species can be separated from other oriental Clavicornalticain the following respects: C. fortepunctataScherer, 1974 (Vietnam) is more elongate ( Medvedev 1996); Clavicornaltica malayanaMedvedev, 1996 (West-Malaysia) is black, the pronotum is impunctate and it is also much larger (1.9 mm) ( Medvedev 1996); Clavicornaltica pusillaScherer, 1974 and C. loebliScherer, 1974 (Sri Lanka) have impunctate elytra ( Medvedev 1996); Clavicornaltica besuchetiScherer, 1974 (Sri Lanka) is larger (>1.5 mm) ( Medvedev 1996); Clavicornaltica iriana sarawacensisMedvedev, 1996 (Borneo) is reddish-black and the elytral punctuation is reduced ( Medvedev 1996); Clavicornaltica tarsalisMedvedev, 1996 (New Guinea) has a widened first protarsomere and an anteriorly widened carina on the 1st abdominal segment ( Medvedev 1996); Clavicornaltica philippinensisScherer, 1979 (Philippines) has a wide plate on the underside of the 1st abdominal sternite; Clavicornaltica trautneriMedvedev, 1993 is much larger (2.1 mm) ( Medvedev 1996); Clavicornaltica schereriBasu & Sen Gupta, 1981 (India) has a posteriorly narrowed pronotum ( Basu and Gupta 1981); Clavicornaltica rileyi Doeberl, 2002 (India) has an anteriorly widened carina on the 1st abdominal segment ( Doeberl2003); Clavicornaltica takizawai Doeberl, 2009 (Nepal) has the spermathecal pump fused with the receptacle and a widened carina on the first abdominal segment ( Doeberl2009); Clavicornaltica tamdaoKonstantinov & Duckett, 2005 (Vietnam) has the spermathecal pump fused with the receptacle ( Konstantinov and Duckett 2005); Clavicornaltica daliKonstantinov & Duckett, 2005 (Yunnan) has the mesosternal processus flat, not convex ( Konstantinov and Duckett 2005); Clavicornaltica vietnamensisKonstantinov & Duckett, 2005 (Vietnam) has the spermathecal pump wider than the receptacle ( Konstantinov and Duckett 2005); Clavicornaltica longshengKonstantinov & Duckett, 2005 (Guangxi) has vaginal palpi very short and the spermathecal pump wider than the receptacle ( Konstantinov and Duckett 2005); Clavicornaltica buecheiMedvedev, 2008 (Sulawesi) is 1.6 times as long as wide and has the carina on the 1st abdominal sternite widened posteriorly ( Medvedev 2008); Clavicornaltica mussardiScherer, 1974 (Sri Lanka) is larger and more elongate; its head is not shagreened ( Scherer 1974); Clavicornaltica mizusawaiSuenaga & Yoshida, 2016 (Taiwan) has a spherical spermathecal receptacle, the carina on the 1st abdominal sternite is widened anteriorly and is flanked by rows of strong punctures, the metafemur is more elongated and the vaginal palpi are diverging, not parallel ( Suenaga and Yoshida 2016); Clavicornaltica sakishimanaSuenaga & Yoshida, 2016 (Japan) has a much more elongate habitus ( Suenaga and Yoshida 2016); finally, Clavicornaltica takimotoiLesage, 1997 (Taiwan) has impunctate elytra and a black body ( Suenaga and Yoshida 2016).
Etymology The species is named after the Belalong river; the new species was recorded in the close vicinity of the river'sleft bank. Following Article 51C of the Code ( ICZN 1999), the species can be referred to as Clavicornaltica belalongensisSchilthuizen et al., 2019, provided the full citation of this publication appears in the bibliography or elsewhere in the referring work.
Distribution Known only from a location near the confluence of the Belalong and Temburong rivers, at 120 m elevation (Kuala Belalong Field Studies Centre; Fig. 1). Five of the six specimens were collected from between buttress roots, whereas only one was from the open forest floor.
Taxon discussion All six specimens we obtained were females. The spermatheca in Clavicornalticais generally diagnostic, perhaps even more so than the aedeagus. This, combined with the fact that we obtained a DNA barcode for the holotype, provides sufficient basis for the description of a new species. We expect that a future taxon expedition to the same location will eventually allow the description of the male as well.
2018-09-27
Winkler sampling
IBER-UBD, Zoology
Taxon Expeditions field course participants
Brunei Darussalam
4.5472
Kuala Belalong Field Studies Centre
115.1571
0
32555
1
1
Holotype
2018-09-27
Winkler sampling
IBER-UBD, Zoology
Taxon Expeditions field course participants
Brunei Darussalam
Kuala Belalong Field Studies Centre
0
32555
1
1
Paratype
2018-09-27
Winkler sampling
IBER-UBD, Zoology
Taxon Expeditions field course participants
Brunei Darussalam
4.5472
Kuala Belalong Field Studies Centre
115.1571
0
32555
1
1
Paratype
2018-09-27
Winkler sampling
IBER-UBD, Zoology
Taxon Expeditions field course participants
Brunei Darussalam
4.5472
Kuala Belalong Field Studies Centre
115.1571
0
32555
1
1
Paratype
2018-09-27
Winkler sampling
IBER-UBD, Zoology
Taxon Expeditions field course participants
Brunei Darussalam
4.5472
Kuala Belalong Field Studies Centre
115.157
0
32555
1
1
Paratype
2018-01-10
Winkler sampling
IBER-UBD, Zoology
Taxon Expeditions field course participants
Brunei Darussalam
4.5472
Kuala Belalong Field Studies Centre
115.1571
0
32555
1
1
Paratype