Advancing butterfly systematics through genomic analysis Zhang, Jing Cong, Qian Shen, Jinhui Song, Leina Grishin, Nick V. The Taxonomic Report of the International Lepidoptera Survey 2025 2025-05-27 12 5 1 201 Grishin Grishin 2025 [390,1043,1755,1788] Insecta Hesperiidae Telegonus Animalia Lepidoptera 109 109 Arthropoda species sobrasus Rhabdoides  http://zoobank.org/ 6783C93A-E535-4D2A-B6E0-EDAFECE13CDE( Figs. 61part, 74u–v, 82, 89 part)   Definition and diagnosis.Our analysis (see above) suggests that Evans misidentified  Eudamus oenander Hewitson, 1876( typelocality in Brazil: Pará). Sequencingof several specimens from South Brazilthat are within Evans’s concept of “ oenander ”reveals that they form a clade sister to  Telegonus creteus(Cramer, 1780)and are genetically differentiated from it at the species level ( Fig. 61) with Fst/ Gmin/COI barcode difference of 0.23/0.025/0.9% (6 bp). This new species keys to “  Astraptes chiriquensis oenander” C.14.30(d) in Evans (1952) (Evans misidentified  Eudamus oenander Hewitson, 1876) and falls within Evans’s concept of this species. The new species is most similar to  Telegonus creteus(also within Evans’s concept of “ oenander”) but differs from it by a shorter and more terminally rounded harpe with a more convex ventral margin in lateral view and a more robust dorsal knob-like process ( Fig. 74u), rounder wings in males, more extensive pale overscaling on the ventral forewing and, correspondingly, more contrasting dark bands, which are also more prominent (compared to  T. creteus) on the dorsal side of wings, a pale brown or yellowish (rather than whitish) and very diffuse tornal area on the ventral forewing, the lack of a green streak along the base of the costal margin on the ventral hindwing, and a more restricted greenish area at the base of the dorsal forewing; and differs from other relatives by the hindwing beneath being dark without a paler submarginal area, only a slightly paler tornal area on the ventral forewing without a defined boundary outlining its, and green (not blue) wings bases above. The ampulla is expanded into a ridge basad reaching half of the valva length, this costa appears bisinuate; the ampulla is separated from the rounded knob-shaped dorsal projection of the harpe by a U-shaped gap ( Fig. 74u). Due to the somewhat cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 2487.2.4:G138A, aly2487. 2.4:T147C, aly3686.6.3:A183G, aly619.11.3:T21A, aly619.11.3:C40T; and COI barcode: C82C, A244G, T292C, C319C, A562A.   Fig. 82.  Telegonus( Rhabdoides) sobrasus  sp. n.holotype ♂ NVG-19071H11 in dorsal (left) and ventral (right) views. Barcode sequence of the holotype. Sample NVG-19071H11, GenBank PV550027, 658 base pairs: AACTCTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACCTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTCCCATTAATAATAGGAGCCCCTGATATAGCTTTTCCTCGTA TGAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATCTCAAGAAGAATTGTTGAAAATGGTGCCGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCATCAAGGAGCATCAGTTGATTTAGCTATTTTCTCTTTACATTTAGCTGGTATTTCTTCTATTCTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCTTTATTTGTATGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT   Type material.  Holotype: ♂deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 82(genitalia Fig. 74u, v), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ BRAZIL: Sta Catarina| Joinville,  0-200m| 26 O19'S 48 O53'W |   27.XI.1988| leg. H. Miers], [DNA sample ID: | NVG-19071H11 | c/o Nick V. Grishin], [DNA sample ID: | NVG-23119F01 | c/o Nick V. Grishin], [genitalia: | NVG240817-52 | c/o Nick V. Grishin], [USNMENT | {QR Code} | 01588534], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides)| sobrasus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection.   Paratypes:6♂♂ and 2♀♀ from Brazil: Bahia? (unlabeled specimens, likely historical collection lot no. 4959, two specimensout of three, from either Bahia or Pará), old, Gomezleg. [ MFNB]:  1♂NVG- 24034A01 and  1♀NVG-24034A02;  1♂NVG-24028D08 Minas Gerais(no detailed locality), old, R. Haensch S.[ MFNB];  Espirito Santo, Leopoldina, 1894 Michaelisleg. [ MFNB]:  1♂NVG-24028C02 and 1♀NVG-24028E04;  1♂NVG-24101B03 Paraná,  Antonina, Guaricica Ecological Reserve,  15 m, GPS −25.3078, −48.6950, J. A. Shuey& P. Labusleg., genitalia RAA 0761 [ MGCL]; and  Santa Catarina(no detailed locality) [ USNM]: 1♂NVG-14111D  03 Apr-1945, from S. S. Nicolaycollection and  1♂NVG-18027G07, USNMENT01465201 from B. Neumögen collection, likely around 1900, Genit. Prep. SRS-1049.   Typelocality. Brazil: Santa Catarina, Joinville, elevation ca.  50 m, GPS −26.3167, −48.8833.   Etymology.The name is derived from the locality in So[uth]+ Bras[il]+ usand is treated as a masculine noun in apposition.   Distribution.Eastern and southern parts of Brazil. 5281752447 1988-11-27 USNM H. Miers Brazil 100 Joinville Joinville 110 110 1 1 Sta Catarina holotype 5281752544 MFNB Gomez Brazil Bahia 110 110 2 Bahia paratype 5281752394 111 111 110 110 1 1 5281752464 [344,616,104,132] 111 111 1 1 5281752483 MFNB R. Haensch S. Minas Gerais 111 111 1 1 Minas Gerais 5281752420 [420,1171,140,168] MFNB Michaelis Leopoldina Leopoldina 111 111 1 Espirito Santo 5281752503 111 111 2 1 1 5281752542 MGCL J. A. Shuey & P. Labus 15 -25.3078 Guaricica Ecological Reserve 7 -48.695 Antonina 111 111 1 1 Parana 5281752372 1945-04-03 USNM S. S. Nicolay Santa Catarina 111 111 1 1 Santa Catarina 5281752460 USNMENT 111 111 1 1