Beyond appearances: the genus Ernassa Walker, 1856 (Lepidoptera, Erebidae, Arctiinae, Phaegopterina) and the description of eight new species Grados, Juan Zootaxa 2024 2024-08-13 5493 4 301 327 Grados 2024 [151,414,834,861] Insecta Erebidae Ernassa Animalia Lepidoptera 14 315 Arthropoda species skinnerorum sp. nov.  ( Figs. 41–50)   Diagnosis:Similar to  E. justina. Differing by the sides of the tegumen, which are not wide, by missing the oblique spot of the margin posterior to the angle of M 3-Cu 1with the marked black line that  E. justinadoes present, the subproximal white spot at M 2-M 3is more elongate in  E. skinnerorum  sp. nov.The genitalia are different: the uncus dorsal processes are flat and rounded in  E. justina, while in  E. skinnerorum  sp. nov.they are highly sclerotized and “˩” shaped; the dorsal process in  E. justinais narrow, elongate and somewhat curved, whereas  E. skinnerorum  sp. nov., presents a very curved process, widening towards the distal end.   Type material:   HOLOTYPEmacho ( Figs. 41–42):  PERÚ. MADRE DE DIOS. 1 male, Albergue Refugio Amazonas, 12°52’30”S, 69°24’35”W, 231 m,  11.ix.2017, D. Couceiro( MUSM, ARCT-836 JGA COLLECTION)(Voucher DNA barcoding, Arct # 499 JGA-MUSM). 9  PARATYPES.  MADRE DE DIOS. 1 female, Albergue Refugio Amazonas, 12°52’30”S, 69°24’35”W, 232 m,  09.x.2016, D. Couceiro( MUSM, ART-476  JGACOLLECTION)(Voucher DNAbarcoding,  ARCT#139 JGA-MUSM)(GENITALIA # JGA-1315, MUSM);  1 male, idem except,  19.x.2016, J. Grados& D. Couceiro( MUSM, ARCT-498 COLLECTION)(Voucher DNAbarcoding, Arct # 161 JGA-MUSM);  1 male, idem except,  16.ix.2017, D. Couceiro( MUSM, ARCT-855  JGACOLLECTION)(Voucher DNAbarcoding, Arct # 518 JGA-MUSM)(GENITALIA # JGA-1293, MUSM);  1 male, idem except,  13.xi.2017( MUSM ARCT-972  JGACOLLECTION)(Voucher DNAbarcoding, Arct # 635 JGA-MUSM);  1 male, idem except,  16.iii.2018, J.D. Shoobridge et al.( MUSM ARCT-1053  JGACOLLECTION)(Voucher DNAbarcoding, Arct # 716 JGA-MUSM);  1 male, idem except,  19.iii.2018( MUSM, ARCT-1060,  JGACOLLECTION)(Voucher DNAbarcoding, Arct # 723 JGA-MUSM);  1 male, idem except,  07.iv.2018( MUSM, ARCT-1077  JGACOLLECTION)(Voucher DNAbarcoding, Arct #740 JGA-MUSM);  1 male, idem except,  25.iv.2018( MUSM, ARCT-1215  JGACOLLECTION)(Voucher DNAbarcoding, Arct # 878 JGA-MUSM)(GENITALIA # JGA-1294, MUSM);  1 male, idem except,  06.v.2018( MUSM ART-1196  JGACOLLECTION)(Voucher DNAbarcoding, Arct #859 JGA-MUSM). Alldeposited in the MUSM.   EXAMINED EXTRA MATERIAL.  MADRE DE DIOS. 1 male, Lago Sandoval, 12°36’S, 69°02’W, 200 m,  07.v.1997, J. Grados; 1 male, Posada Amaz., 12°48’08”S, 69°17’59”W, 280 m,  8.x.2004, T. Mc Cabe;  1 male, Albergue Refugio Amazonas, 12°52’30”S, 69°24’35”W, 231 m,  28.xii.2016, D. Couceiro;  1 male, Albergue RefugioAmazonas, 12°52’30”S, 69°24’35”W, 231 m,  04.vii.2018, J.D. Shoobridge et al.;  1 male, idem except,  25.ix.2018;  1 male, idem except,  02.x.2018; 1 male, idem except,  26.x.2018;  1 male, idem except,  09.iv.2019;  1 male, idem except,  17.vii.2019;  1 male, idem except,  30.vii.2019;  1 male, Tambopata Research Center, 13°08’03”S, 69°36’39”W, 239 m,  01.iii.–31.x.2021, A. Avellaneda, G. Serrano& J. Grados;  1 male, idem except,  01.xi.2021, G. Serrano& J. Grados;  1 male, idem except,  06.xi.2021;  1 male, idem except,  26.xi.2021;  1 male, idem except,  06.xi.2021;  1 male, P. N. Bahuaja-Sonene, 13°11’35”S,70°07’56”W, 353 m,  14.vi.2013, J. Grados, E. Rázuri& J. Barrientos. All deposited in the MUSM.   FIGURES 41–44.  Ernassa skinnerorum  sp. nov.41–42. Male. Holotype. 41. Dorsal view. 42. Ventral view. 43–44. Female. Albergue Refugio Amazonas 43. Dorsal view. 44. Ventral view. Scales=5 mm.  Male. Forewing span ( 22–26 mm) (n=10). Head. Reddish. Scape Reddish, flagellum brown with a white spot on the distal segments. Thorax: Orange-red. Legs reddish, the outer margin of the front tibiae with a narrow brown line. Forewing. Elongate. Dorsal. Orange red. Half of the anterior margin brown. Posterior margin with leaden scales, except for the base. Termen brown. Veins with brown scales. Subproximal rhomboid orange spot, delimited by an antemedial band of leaden scales and an oblique medial band of leaden scales with a thin reddish line. Poorly defined orange spots in the discal cell. A subproximal ovoid white spot at M 2-M 3. With unclearly defined scattered spaces of orange, reddish and leaden scales towards the outer margin area. Ventral. Orange red, slightly lighter from Cu 2. Most of the anterior margin brown. Termen brown. Hindwing. Reddish, elongate and rhomboid with rounded angles. Dorsal. Reddish, lighter towards the central part. Ventral. Reddish, with the same traits as the dorsal side. Abdomen. Reddish. Male genitalia( Figs. 45–48) (GENITALIA # JGA-1293, 1294, MUSM): Tegumen with wide sides, its anterior margin shaped as an inverted “U”, mesal margins very close together at the medial part. Uncus base wider than the distal part of the tegumen; near its base, two “˩”-shaped lateral processes, sclerotized with abundant long and thick bristles on their mesal side; distal part triangular, pointed and hook-shaped at its end, a concave notch on its ventral part. Saccus absent. Valva. Lateral view: base wide, rectangular, dorsal margin convex; ventral process membranous, truncated with setae present; dorsal process sclerotized, narrow at its base, widening distally; end rounded with abundant short setae at the dorsal area; strongly curved downward ventrally. Ventral view: wide, mesal margins almost close together at the base, receding distally, ending sinusoidally towards the dorsal process; setae on the mesal margins. Juxta trapezoidal, curved dorso-ventrally, the central part membranous. Transtilla sclerotized, wide, oval, dome-shaped at its distal end. Aedeagus elongate and somewhat sinusoid; coecum penis short; vesica membranous, short, with minute spicules in the distal area.   FIGURES 45–48. Genitalia of  Ernassa skinnerorum  sp. nov.Male (Genitalia # JGA-1293, MUSM). 45. Dorsal view. 46. Ventral view. 47. Lateral view. 48. Aedeagus. Scales= 1 mm.   FIGURES 49–50. Genitalia of  Ernassa skinnerorum  sp. nov.Male (Genitalia # JGA-1315, MUSM). 49. Dorsal view. 50. Ventral view. Scales= 1 mm.  Female( Figs. 49–50). Forewing span ( 28 mm) (n=1). With the same characteristics as the male, except rami are smaller than the flagellum width and do not bear retinaculum. Four bristles at the frenulum. Genitalia ( Figs. 49–50) (Genitalia # JGA1315, MUSM). Posterior part of the eighth tergite sclerotized. Papillae taller than wide, with a widening rounded dorsolaterally; with greater pubescence at the dorsal part. Posterior processes longer and wider than the anterior ones; the latter almost undeveloped. Eighth sternite with two lateral extensions with sinusoid posterior margins. Lamella antivaginalis and postvaginalis sclerotized. Ductus bursae short, flattened, and sclerotized. Cervix bursae wide and membranous. Corpus bursae globose and membranous. Two signa, long and narrow, located at the left side: a dorsal one and a ventral one. Ductus seminalis from the anterior and dorsal part of the Cervix bursae. Specimen Barcoding data are: MUSM, ARCT-476 COLLECTION; Voucher DNA barcoding, ARCT# 139 JGA-MUSM.  Etimology:  skinnerorumis a noun in plural genitive, dedicated to Andrew Skinner y Valerie Skinner for being the first to collect specimens of the new species in the project Discovery new speciesin Tambopata.  Barcoding: The mitochondrial DNA sequence ( COI) of one of the paratypesis as follows (Voucher DNA barcoding, ARCT #635 JGA, MUSM) (GenBank: BankIt2839965 gnl|uoguelph|RFEWA635-18.COI-5P PP911852) (See Table 1). AACATTATACTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCATTAAGTTTACTAATTCGT GCTGAATTAGGAAATCCAGGATCCTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCACAT GCTTTTATTATAATTTTTTTTATGGTTATACCAATTATAATTGGAGGTTTCGGTAATTGATTAGTCCCTT TAATATTAGGAGCTCCGGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGACTCTTACCCCCAT CATTAACTTTATTAATCTCAAGAAGAATTGTTGAAAATGGAGCCGGAACAGGATGAACAGTT TATCCCCCACTTTCATCTAATATTGCCCATGGTGGAAGTTCAGTAGATTTAGCTATCTTTTCTTTA CATTTAGCGGGAATCTCTTCAATTTTAGGTGCTATTAACTTTATTACAACAATTATTAATATACGAT TAAATAACTTATCATTTGATCAAATACCATTATTTGTGTGAGCAGTAGGAATTACTGCATTCCTATTAT TACTTTCATTACCTGTTTTAGCAGGGGCTATTACAATACTTTTAACTGATCGAAACTTAAATACCT CATTTTTTGATCCTGCAGGAGGGGGAGATCCAATTCTCTATCAACACTTATTT   Distribution:In the southeastern Peru(department of Madre de Dios).   Remarks:One of the few species with a known female. Due to the morphological similarity and color pattern, it is difficult to relate sexes of the same species. This will be possible through breeding and DNA analysis. In our case, the relationship of the sexes is based on genetic distances of sympatric male and female specimens and by comparing barcoding DNA sequences. The genetic distances of the female compared to the 9 males, were between 0% and 0.7%. 4928914411 2017-09-11 MUSM, JGA COLLECTION, JGA-MUSM D. Couceiro Peru 231 -12.875 Albergue Refugio Amazonas 21 -69.40972 14 315 ARCT-836 1 1 Madre de Dios holotype 4928914422 2016-10-09 2018-05-06 2016-10-09 MUSM, JGA, COLLECTION, JGA-MUSM, EXAMINED, EXTRA, MATERIAL D. Couceiro & J. Grados & J. D. Shoobridge & All Peru 232 -12.875 Albergue Refugio 21 -69.40972 14 315 ART-476, ARCT #139, JGA-1315, ARCT-498, ARCT-855, JGA-1293, ARCT-972, ARCT-1053, ARCT-1060, ARCT-1077, ARCT-1215, JGA-1294, ART-1196 1 1 8 Madre de Dios paratype 4928914337 2016-10-09 2018-05-06 2016-10-09 MUSM, JGA, COLLECTION, JGA-MUSM, EXAMINED, EXTRA, MATERIAL D. Couceiro & J. Grados & J. D. Shoobridge & All Peru 232 -12.875 Albergue Refugio 21 -69.40972 14 315 ART-476, ARCT #139, JGA-1315, ARCT-498, ARCT-855, JGA-1293, ARCT-972, ARCT-1053, ARCT-1060, ARCT-1077, ARCT-1215, JGA-1294, ART-1196 1 1 8 Madre de Dios paratype 4928914390 2016-10-09 2018-05-06 2016-10-09 MUSM, JGA, COLLECTION, JGA-MUSM, EXAMINED, EXTRA, MATERIAL D. Couceiro & J. Grados & J. D. Shoobridge & All Peru 232 -12.875 Albergue Refugio 21 -69.40972 14 315 ART-476, ARCT #139, JGA-1315, ARCT-498, ARCT-855, JGA-1293, ARCT-972, ARCT-1053, ARCT-1060, ARCT-1077, ARCT-1215, JGA-1294, ART-1196 1 1 8 Madre de Dios paratype 4928914305 2016-10-09 2018-05-06 2016-10-09 MUSM, JGA, COLLECTION, JGA-MUSM, EXAMINED, EXTRA, MATERIAL D. Couceiro & J. Grados & J. D. Shoobridge & All Peru 232 -12.875 Albergue Refugio 21 -69.40972 14 315 ART-476, ARCT #139, JGA-1315, ARCT-498, ARCT-855, JGA-1293, ARCT-972, ARCT-1053, ARCT-1060, ARCT-1077, ARCT-1215, JGA-1294, ART-1196 1 1 8 Madre de Dios paratype 4928914364 2016-10-09 2018-05-06 2016-10-09 MUSM, JGA, COLLECTION, JGA-MUSM, EXAMINED, EXTRA, MATERIAL D. Couceiro & J. Grados & J. D. Shoobridge & All Peru 232 -12.875 Albergue Refugio 21 -69.40972 14 315 ART-476, ARCT #139, JGA-1315, ARCT-498, ARCT-855, JGA-1293, ARCT-972, ARCT-1053, ARCT-1060, ARCT-1077, ARCT-1215, JGA-1294, ART-1196 1 1 8 Madre de Dios paratype 4928914329 2016-10-09 2018-05-06 2016-10-09 MUSM, JGA, COLLECTION, JGA-MUSM, EXAMINED, EXTRA, MATERIAL D. Couceiro & J. Grados & J. D. Shoobridge & All Peru 232 -12.875 Albergue Refugio 21 -69.40972 14 315 ART-476, ARCT #139, JGA-1315, ARCT-498, ARCT-855, JGA-1293, ARCT-972, ARCT-1053, ARCT-1060, ARCT-1077, ARCT-1215, JGA-1294, ART-1196 1 1 8 Madre de Dios paratype 4928914359 2016-10-09 2018-05-06 2016-10-09 MUSM, JGA, COLLECTION, JGA-MUSM, EXAMINED, EXTRA, MATERIAL D. Couceiro & J. Grados & J. D. Shoobridge & All Peru 232 -12.875 Albergue Refugio 21 -69.40972 14 315 ART-476, ARCT #139, JGA-1315, ARCT-498, ARCT-855, JGA-1293, ARCT-972, ARCT-1053, ARCT-1060, ARCT-1077, ARCT-1215, JGA-1294, ART-1196 1 1 8 Madre de Dios paratype 4928914312 2016-10-09 2018-05-06 2016-10-09 MUSM, JGA, COLLECTION, JGA-MUSM, EXAMINED, EXTRA, MATERIAL D. Couceiro & J. Grados & J. D. Shoobridge & All Peru 232 -12.875 Albergue Refugio 21 -69.40972 14 315 ART-476, ARCT #139, JGA-1315, ARCT-498, ARCT-855, JGA-1293, ARCT-972, ARCT-1053, ARCT-1060, ARCT-1077, ARCT-1215, JGA-1294, ART-1196 1 1 8 Madre de Dios paratype 4928914419 2016-10-09 2018-05-06 2016-10-09 MUSM, JGA, COLLECTION, JGA-MUSM, EXAMINED, EXTRA, MATERIAL D. Couceiro & J. Grados & J. D. Shoobridge & All Peru 232 -12.875 Albergue Refugio 21 -69.40972 14 315 ART-476, ARCT #139, JGA-1315, ARCT-498, ARCT-855, JGA-1293, ARCT-972, ARCT-1053, ARCT-1060, ARCT-1077, ARCT-1215, JGA-1294, ART-1196 1 1 8 Madre de Dios paratype 4928914351 2016-10-09 2018-05-06 2016-10-09 MUSM, JGA, COLLECTION, JGA-MUSM, EXAMINED, EXTRA, MATERIAL D. Couceiro & J. Grados & J. D. Shoobridge & All Peru 232 -12.875 Albergue Refugio 21 -69.40972 Lago Sandoval 14 315 ART-476, ARCT #139, JGA-1315, ARCT-498, ARCT-855, JGA-1293, ARCT-972, ARCT-1053, ARCT-1060, ARCT-1077, ARCT-1215, JGA-1294, ART-1196 1 1 8 Madre de Dios paratype 4928914330 [1148,1436,1771,1797] 2016-10-09 2018-05-06 2016-10-09 MUSM, JGA, COLLECTION, JGA-MUSM, EXAMINED, EXTRA, MATERIAL D. Couceiro & J. Grados & J. D. Shoobridge & All Peru 232 -12.875 Albergue Refugio 21 -69.40972 Lago Sandoval 14 315 ART-476, ARCT #139, JGA-1315, ARCT-498, ARCT-855, JGA-1293, ARCT-972, ARCT-1053, ARCT-1060, ARCT-1077, ARCT-1215, JGA-1294, ART-1196 1 1 8 Madre de Dios paratype 4928914420 [151,987,1806,1833] 2016-12-28 Couceiro & Albergue Refugio Peru 231 -12.875 Amazonas 21 -69.40972 14 315 1 1 Amazonas paratype 4928914400 2016-12-28 2021-11-26 2018-07-04 Couceiro & Albergue Refugio Peru 231 -12.875 Amazonas 21 -69.40972 14 315 1 1 Amazonas paratype 4928914415 [963,1342,1842,1869] 2016-12-28 2021-11-26 2018-07-04 Couceiro & Albergue Refugio Peru 231 -12.875 Amazonas 21 -69.40972 14 315 1 1 Amazonas paratype 4928914360 2016-12-28 2021-11-26 2018-07-04 Couceiro & Albergue Refugio Peru 231 -12.875 Amazonas 21 -69.40972 14 315 1 1 Amazonas paratype 4928914354 [813,1187,1879,1905] 2016-12-28 2021-11-26 2018-07-04 Couceiro & Albergue Refugio Peru 231 -12.875 Amazonas 21 -69.40972 14 315 1 1 Amazonas paratype 4928914320 2016-12-28 2021-11-26 2018-07-04 Couceiro & Albergue Refugio Peru 231 -12.875 Amazonas 21 -69.40972 14 315 1 1 Amazonas paratype 4928914333 [298,689,1915,1941] 2016-12-28 2021-11-26 2018-07-04 Couceiro & Albergue Refugio Peru 231 -12.875 Amazonas 21 -69.40972 14 315 1 1 Amazonas paratype 4928914399 2016-12-28 2021-11-26 2018-07-04 Couceiro & Albergue Refugio Peru 231 -12.875 Amazonas 21 -69.40972 14 315 1 1 Amazonas paratype 4928914397 2016-12-28 2021-11-26 2018-07-04 Couceiro & Albergue Refugio Peru 231 -12.875 Amazonas 21 -69.40972 14 315 1 1 Amazonas paratype 4928914425 [275,649,1987,2013] 2016-12-28 2021-11-26 2018-07-04 Couceiro & Albergue Refugio Peru 231 -12.875 Amazonas 21 -69.40972 14 315 1 1 Amazonas paratype 4928914307 [657,1032,1987,2013] 2016-12-28 2021-11-26 2018-07-04 Couceiro & Albergue Refugio Peru 231 -12.875 Amazonas 21 -69.40972 14 315 1 1 Amazonas paratype 4928914424 [1040,1414,1987,2013] 2016-12-28 2021-11-26 2018-07-04 MUSM Couceiro & Albergue Refugio Peru 231 -12.875 Amazonas 21 -69.40972 14 315 1 1 Amazonas paratype 4928914374 2016-12-28 2021-11-26 2018-07-04 MUSM Couceiro & Albergue Refugio Peru 231 15 316 -12.875 Amazonas 21 -69.40972 14 315 1 1 Amazonas paratype