Four new species and one new subspecies of Arctiinae (Lepidoptera: Erebidae) from the Tambopata river, Madre de Dios, Peru Grados, Juan Zootaxa 2018 2018-06-14 4434 1 29 48 Grados, 2018 Grados 2018 [151,371,654,680] Insecta Erebidae Aphyle GBIF Animalia Lepidoptera 2 31 Arthropoda species niedmandi sp. nov.     Holotypemale( Figs. 1–2):   PERU, Madre de Dios, Albergue Refugio Amazonas, 12°52'30''S, 69°24'35''W,  231m,  17.vii.2016( D. Couceiro).  20 paratypes( 15 malesand 5 females):   PERU, Loreto,  1 male, Campamento Paiche( Río Curaray), 01°29'25''S, 75°23'53''W,  200m,  02.iii.2008( W. Yawuarcani);  1 male, Campamento Dorado( Quebrada Rumiyacu), 01°48'09''S, 75°29'14''W,  230m,  23.ii.2008( W. Yawuarcani).   Ucayali,  1 male, Quebrada Shaguauya, 08°39'12''S, 73°21'25''W,  275m,  04.xi.2008( S. Carbonel).   Junin,  1 male, Río Venado,  1050m,  01.i.2009( V. Izerskyy).    CUSCO, 1 male,  1 female, Cashiriari, 11°52'S, 72°39'W,  690m,  02.xii.1997( J. Grados);  1 male, C.C. Kitaparay, 12°12'47.73''S, 72°49'11.42''W,  474m,  13.xi.2009( C. Espinoza& E. Rázuri);  1 male, C.C. Timpia, 12°06'52.69''S, 72°49'48.64''W,  486m,  21.x.2009( M. Alvarado& E. Rázuri);  1 female, 12 kmO de Sonampiato, 12°39'52.07''S, 73°14'35.01''W,  887m,  30.v.2011( C. Espinoza);  1 female, Campamento Comerciato, 12°47'S, 73°22'W,  1360m,  18.xi.2002( J. Grados).  Madre de Dios,  1 male, CICRA( Río Los Amigos), 12°33'36.3''S, 70°06'17.3''W,  280m,  10.xii.2005( J. Grados); 1 female, idem except, 06.xii.2005; 1 male, idem except, 01.v.2006(A. Asenjo); 1 male, idem except, 29.x.2006(A. Asenjo); 1 male, idem except, 17.xi.2006(A. Asenjo); 1 male, idem except, 23.viii–15.ix.2008(A. Asenjo);  1 female, Albergue Refugio Amazonas, 12°52'30''S, 69°24'35''W,  231m,  07.iv.2016( Harald Niedman, Karen Niedman, Emily Niedman, Dominic Niedman& D. Couceiro); 1 male, idem except, 10.viii.2016(D. Couceiro); 1 male, idem except, 02.x.2016(D. Couceiro); 1 male, idem except, 07.x.2016(D. Couceiro).   Diagnosis(male and female): Head creamy, frontoclypeous light brown, with a black spot between antennae. Thorax creamy white, patagia black with blue iridescence. Two black dots on medial part of mesoscutum, and another two on central part of mesoscutellum. Forewing creamy brown, with two small black spots on its base. A continuous series of five black spots close to wing base, from costal margin until below vein 1A+2A,, arranged crosswise. Black dots close to apex and tornus. Hindwing diaphanous creamy white, with creamy hairs on inner margin. Abdomen creamy yellow dorsally, whitish ventrally.   Description male( Figs. 1–2) and female( Figs.3–4). Forewing span: 9–12 mmin males (n=16), 20–21 mmin females (n=5). Head:Frontoclypeous light brown. Between the scapes, a black line. Posterior margin of vertex with light brown scales. Palpi black with blue iridescence, except for the frontal surface of first palpomere, and proximal frontal surfaces of second and third palpomeres, creamy white. Occiput whitish laterally. Antennae creamy, slightly bipectinated with very small rami. Thorax:Creamy white. Patagia black with blue iridescence, and a white line on anterior surface, plus a creamy transversal line before posterior margin. Tegulae creamy with a black line across situated before the beginning of the first pair of wings and a black spot towards tegulae posterior. Two black dots on medial surface of mesoscutum, and two other on the medial part of the mesoscutellum. Creamy hair-like scales laterally between metascutum and metascutellum. Prothoracic legs creamy white. Prothoracic femora with a black spot on inner surface, about three quarters from distal end of the segment. Another black spot on inner distal surface of tibia. Proximal surface of the last four tarsal segments brown scaled. Mesothoracic legs creamy with two brown spots, on distal end of femora and on proximal end of tibiae. Metathoracic legs entirely creamy.   FIGURES 1–4.  Aphyle niedmandiGrados new species. 1. Holotype male, dorsal. 2. Holotype male, ventral. 3. Paratype female, dorsal (CICRA, Río Los Amigos). 4. Paratype female, ventral. Scales=10 mm.   FIGURES 5–8. Genitalia of  Aphyle niedmandiGrados, new species. (Genitalia # JGA–729). 5. Dorsal view. 6. Ventral view. 7. Lateral view. 8. Aedeagus. Scales= 1 mm.  Forewing:Dorsal surface with costal margin sandy brown. Two small black spots on the wing base. A continuous series of five black spots close to the wing base, going from costal margin until below vein 1A+2A, arranged crosswise. Very close to these, a brown spot from C to the 2A. Also very close to these and towards the distal surface, a black spot between C and 2A. Two black spots inside discal cell, the larger one close to the wing base. On proximal surface of cell C1-C2, a black elongated spot. Below the beginning of Cu2-1A, another black elongated spot. A large, elongated spot on anal cell, comprising the vein 2A and reaching posterior margin. Veins M1, M2 and M3 brown. This color not reaching the termen. Three black points near apex: between veins R3 and R4, R4 and R5, and R5 and M1. Three black spots reaching termen, wider towards mesal area; between M1-M2, M2-M3 and M3-CU1. A sandy brown spot towards the proximal region. A series of black dots located between M3 and tornus: an elongated dot obliquely arranged on subdistal part of M3-Cu1; a dot subdistal on Cu1-Cu2; a black spot on Cu2-1A; a subdistal black dot on 1A-2A; finally, a dot on tornus. Tornus with a sandy brown spot. Ventral surface creamy whitish and hyaline. A series of black dots present near apex, similar to those on dorsal side, but smaller: between veins R3 and R4, R4 and R5, and R5 and M1. Three black spots reaching termen and wider towards mesal area, but nos as dark as the dorsal side: between M1-M2, M2-M3 and M3-CU1. Hindwing:Both dorsal and ventral surfaces identical. Creamy witish and hyaline, with creamy hairs on inner margin. Abdomen:Creamy yellowish dorsally, slightly hairy on first three terga, with creamy and white hairs on remaining terga. White ventrally. Male genitalia( Figs. 5–8) (Genitalia # JGA 729): Tegumen short. Uncus wide at base; in dorsal view thinning towards distal end, and more sclerotized towards the tip; in lateral view, wider medially. Sacculus elongated and ventral process of valvae short and rounded. Dorsal process of valvae elongated and curved, twice the length of ventral process. Aedeagus with small caecum penis. Vesica with a membranous process towards the ventral side and elongated dorsal process. Numerous cornuti on a well delimited on distal process.   Etymology:  niedmandiis a singular genitive noun, dedicated to the Niedmand family for being the first ones to collect specimens of the new species at the Refugio AmazonasLodge.   Distribution: Known from the departments of Loreto, Ucayali, Juninand Madre de Dios(Peruvian Amazon).  Barcoding:The access number to Genbank is MG837873. The mitochondrial DNA sequence (COI) of one of the paratypesis as follows (Voucher MUSM– ArctiinaeVB # 33):  AACTTTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCTTTAAGTTTATTAATCCGAGCTG AATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATCGTTACTGCTCATGCTTTT ATCATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAATTGATTAGTACCTTTAATATTA GGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTCTGACTTCTTCCCCCATCTTTAACTT TATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCCCTTTCA TCAAATATCGCCCATGGAGGAAGATCTGTAGATCTAGCTATTTTCTCCCTACATTTAGCAGGTATCTCAT CAATTTTAGGTGCAATTAATTTTATTACCACAATCATTAATATACGATTAAATAATTTATCATTTGATCAA ATACCATTATTTGTTTGAGCAGTAGGTATTACAGCATTTTTATTACTATTATCTCTCCCAGTTTTAGCTGG AGCTATTACAATATTATTAACTGATCGAAATTTAAACACATCTTTTTTTGACCCTGCTGGAGGGGGGGA TCCCATCCTCTATCAACATTTATTT   Remarks:  Aphyle cuneata Hampson, 1905was described from a male specimen of the Potaro River ( Guyana), typedeposited at the NHMUK ( Figs. 9–10). The new species has a color pattern and external morphology similar to  A. cuneata, differing from it in the black spots on the wing base: The spot at very base of the wing and the largest proximal patch are continuos in A. cuneate, while in A. niedmandiare discontinuous, with tiny spots. The genitalia morphology is very similar in both species; the most notorious differences are in the antennae and eighth tergite and sternite. Antennae are bipectinated in both taxa, but the rami have almost the same length of the shaft in  A. cuneata, giving it a pentagonal shape ( Fig. 15), while in  A. niedmandithey are shorter, so the flagellomeres are rectangular shaped ( Fig. 16). The eighth tergite of  A. cuneatahas large lateral apodemes, one quarter the length of the entire tergite ( Fig. 11). In  A. niedmandithe tergite is wider, and the apodemes are small ( Fig. 12). In the eighth sternite, the apodeme of  A. cuneatais broad and has lateral extensions ( Fig. 13), whereas in  A. niedmandithe apodeme is narrow and continuous along the anterior border ( Fig. 14).   Aphyle cuneataoccurs in Guyana, French Guiana(MHNP), Ecuador( Piñas et al. 2000), and Peru. For the latter country, there are records from the departments of Loreto, Cuscoand Madre de Dios.  Aphyle niedmandi, on its turn, has been recorded from Loreto, Ucayali, Junín, Cuscoand Madre de Dios. The genetic distance between both species is 5.52%. 1849198319 2016-07-17 PERU D. Couceiro Peru 231 -12.875 Madre de Dios 21 -69.40972 2 31 1 Madre de Dios holotype 1849198412 [542,1176,797,822] PERU Peru Loreto 2 31 40 5 15 Loreto paratype 1849198246 2008-03-02 W. Yawuarcani Peru 200 -1.4902778 Rio Curaray 21 -75.398056 Campamento Paiche 2 31 1 1 Loreto paratype 1849198321 2008-02-23 W. Yawuarcani & Ucayali Peru 230 -1.8025 Quebrada Rumiyacu 21 -75.48722 Campamento Dorado 2 31 1 1 Ucayali paratype 1849198323 2008-11-04 S. Carbonel & Junin Peru 275 -8.653333 Quebrada Shaguauya 21 -73.35694 2 31 1 1 Junin paratype 1849198322 2009-01-01 V. Izerskyy Peru 1050 Rio Venado 2 31 1 1 Junin paratype 1849198247 [423,613,941,966] CUSCO Peru CUSCO 2 31 1 1 CUSCO paratype 1849198320 [624,1411,941,966] 1997-12-02 J. Grados Peru 690 -11.866667 Cashiriari 1294 -72.65 2 31 1 1 CUSCO paratype 1849198326 2009-11-13 C. Espinoza & E. Razuri Peru 474 -12.213258 Kitaparay 1 -72.81984 2 31 1 1 CUSCO paratype 1849198253 2009-10-21 M. Alvarado & E. Razuri Peru 486 -12.114636 Timpia 1 -72.83018 2 31 1 1 CUSCO paratype 1849198410 2011-05-30 C. Espinoza Peru 887 -12.664463 Sonampiato 1 -73.24306 2 31 1 1 CUSCO paratype 1849198417 2002-11-18 J. Grados & de Dios Peru 1360 -12.783334 Campamento Comerciato 1292 -73.36667 2 31 1 1 Madre de Dios paratype 1849198328 2005-12-10 CICRA J. Grados Peru 280 -12.560083 Rio Los Amigos 1 -70.104805 2 31 1 1 Madre de Dios paratype 1849198318 2016-04-07 Harald Niedman & Karen Niedman & Emily Niedman & Dominic Niedman & D. Couceiro Peru 231 -12.875 Amazonas 21 -69.40972 2 31 1 1 Amazonas paratype