Anahita medog S. Li & Yao, 2022

Chu, Chang, Lu, Ying, Li, Shuqiang & Yao, Zhiyuan, 2022, Taxonomic notes on eleven species of the subfamily Cteninae (Araneae, Ctenidae) from Asia, Biodiversity Data Journal 10, pp. 96003-96003 : 96003

Anahita medog S. Li & Yao sp. n.

Materials

Type status: Holotype. Occurrence: recordedBy: J. Wu; individualCount: 1; sex: male; lifeStage: adult; Taxon: order: Araneae ; family: Ctenidae ; genus: Anahita ; Location : country: China; stateProvince: Tibet; municipality: Nyingchi ; locality: Medog County ; verbatimLocality: Baibung Town , near the Jiagagou Bridge ; verbatimElevation: 805 m a.s.l.; verbatimLatitude: 29°15.067'N; verbatimLongitude: 95°11.717'E; Event: samplingProtocol: Collected by hand in leaf litter; year: 2016; month: 6; day: 18; Record Level: institutionCode: IZCAS-Ar 43536 Type status: Paratype. Occurrence: recordedBy: J. Wu; individualCount: 1; sex: female; lifeStage: adult; Taxon: order: Araneae ; family: Ctenidae ; genus: Anahita ; Location : country: China; stateProvince: Tibet; municipality: Nyingchi ; locality: Medog County ; verbatimLocality: Baibung Town , near the Jiagagou Bridge ; verbatimElevation: 805 m a.s.l.; verbatimLatitude: 29°15.067'N; verbatimLongitude: 95°11.717'E; Event: samplingProtocol: Collected by hand in leaf litter; year: 2016; month: 6; day: 18; Record Level: institutionCode: IZCAS-Ar 43537

Description

Male (IZCAS-Ar 43536): PL 2.7, PW 2.3, AW 0.9, OL 2.4, OW 1.4. Eye diameters and interdistances: AME 0.13, ALE 0.10, PME 0.22, PLE 0.19, AME-AME 0.10, AME-ALE 0.22, PME-PME 0.16, PME-PLE 0.23, AME-PME 0.11, ALE-PLE 0.14, clypeus AME 0.10, clypeus ALE 0.37. Palp and leg measurements: palp 4.1 (1.5, 0.6, 0.8, -, 1.2), I missing, II 13.0 (3.6, 1.2, 3.7, 3.3, 1.2), III 10.9 (2.8, 1.1, 2.8, 3.0, 1.2), IV 16.0 (4.1, 1.1, 4.2, 5.1, 1.5). Leg formula 4123. Spination of palp and legs: palp 023, 000, 0211; femora II p112, d111, r012, III p112, d111, r112, IV p112, d111, r012; patellae II-IV 101; tibiae II p110, d101, r100, v22222, III p11, d111, r11, v222, IV p11, d111, r11, v22; metatarsi II p111, r111, v222, III p112, d010, r112, v222, IV p112, d010, r112, v2222. Chelicerae with 3 promarginal, 4 + 1 retromarginal teeth and with elongated patch of 6 tiny denticles along entire cheliceral furrow. Leg claws II with 9, III with 5 and IV with 7 secondary teeth. Position of tarsal organ: II 1.06, III 0.85, IV 1.14.

Palp (Fig. 10 a-c). Palpal tibia without RTA and intrasegmental sclerite, distally with retrolateral stout spine. Cymbium tip conical. Embolus (Fig. 14 a) arising at 6.30 o’clock position, with wide base and narrow tip and a membranous apophysis apically. Conductor absent. Tegular apophysis arising nearly centrally from tegulum.

Colour (Fig. 11 c and d). Black to yellowish. Dorsal prosoma with two parallel black lateral bands and distinctly marked fovea. Sternum, ventral coxae, labium and gnathocoxae yellowish. Chelicerae yellowish with longitudinal lines. Palps and legs yellowish. Dorsal opisthosoma black with light median band. Lateral opisthosoma spotted. Ventral opisthosoma yellowish with lateral black patterns. Spinnerets dark.

Female (IZCAS-Ar 43537): PL 2.9, PW 2.4, AW 1.2, OL 3.5, OW 2.0. Eye diameters and interdistances: AME 0.13, ALE 0.11, PME 0.19, PLE 0.18, AME-AME 0.13, AME-ALE 0.26, PME-PME 0.21, PME-PLE 0.24, AME-PME 0.15, ALE-PLE 0.17, clypeus AME 0.10, clypeus ALE 0.38. Palp and leg measurements: palp 3.2 (0.9, 0.6, 0.8, -, 0.9), I 10.4 (2.9, 1.3, 3.1, 2.2, 0.9), II 9.3 (2.7, 1.2, 2.5, 2.0, 0.9), III 8.3 (2.3, 1.1, 2.1, 2.0, 0.8), IV 12.4 (3.3, 1.2, 3.1, 3.6, 1.2). Leg formula 4123. Spination of palp and legs: palp 020, 010, 010, 2012; femora I p011, d111, r021, II p011, d111, r011, III p012, d111, r112, IV p002, d111, r012; patellae I-II 000, III-IV 101; tibiae I v22212, II v22222, III-IV p11, d111, r11, v222; metatarsi I-II v222, III p112, d010, r112, v222, IV p112, r112, v2222. Chelicerae with 3 promarginal, 4 retromarginal teeth and with elongated patch of 5 tiny denticles along entire cheliceral furrow. Palpal claw with 5 secondary teeth, leg claws I-II with 5, III with 4 and IV with 7 secondary teeth. Position of tarsal organ: I 0.79, II 0.72, III 0.70, IV 1.00.

Copulatory organ (Fig. 11 a and b). Lateral teeth arising posteriorly from median plate. Median plate with a large n-shaped sclerite. Copulatory openings hidden under median plate. Copulatory ducts nearly triangular. Spermathecae nearly cylindrical. Fertilisation ducts pointing anteriorly.

Colour (Fig. 11 e and f). As in male.

Diagnosis

Small Ctenidae (total length male 5.1, female 6.4). The species resembles A. maolan Zhu, Chen & Song, 1999 (see Zhu et al. 1999: figs 1-5; Yin et al. 2012: fig. 473a-e; Marusik and Omelko 2016: figs 1-13 and 32-34) by having similar distal retrolateral spine, tegular apophysis (Fig. 10 a-c) and fertilisation ducts (Fig. 11 b), but can be distinguished by the embolus arising at 6.30 o’clock position, its tip with membranous apophysis (Fig. 10 b and Fig. 14 a; embolus arising centrally from tegulum, its tip without membranous apophysis in A. maolan ), by the median plate with a large n-shaped sclerite (Fig. 11 a; absent in A. maolan ), by the lateral teeth pointing postero-medially (Fig. 11 a; lateral teeth pointing medially in A. maolan ) and by the spermathecae nearly cylindrical (Fig. 11 b; spermathecae nearly wavy in A. maolan ).

Etymology

The specific name refers to the type locality and is a noun in apposition.

Distribution

China (Tibet, type locality; Fig. 1 ).

DNA Barcode

Male (IZCAS-Ar 43536):.

TGTTTGGAGCTTGAGCTGCTATAGCTGGAACAGCAATAAGAGTTTTAATTCGAATGGAATTAGGACATTCTGGTAGATTGTTAGGAGATGATCATTTATATAATGTAATTGTAACGGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCTATTTTGATTGGGGGCTTTGGTAATTGGTTGGTTCCTTTAATGTTAGGGGCTCCGGATATATCTTTTCCTCGAATAAATAATTTATCCTTTTGATTATTACCGCCTTCTTTATTTTTGTTGTTTATATCTTCTATAGTTGAGATAGGGGTTGGAGCAGGTTGAACGGTTTATCCTCCTTTAGCTTCTAGAATTGGGCATATGGGAAGTTCAATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGTGCTTCTTCTATTATAGGTGCTGTGAATTTTATTTCTACTATTATTAATATACGATTAATAGGAATAACAATGGAGAAGATCCCTTTATTTGTATGATCGGTTTTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCAGGAGCTATTACTATATTATTGACTGATCGAAATTTTAATACTTCTTTTTTTGACCCTGCTGGAGGTGGAGATCCTATTTTATTTCAACATTTATTTTGATTTTTTG (GenBank accession number OP572101).

Female (IZCAS-Ar 43537):

TGTTTGGAGCTTGAGCTGCTATAGCTGGAACAGCAATAAGAGTTTTAATTCGAATGGAATTAGGACATTCTGGTAGATTGTTAGGAGATGATCATTTATATAATGTAATTGTAACGGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCTATTTTGATTGGGGGCTTTGGTAATTGGTTGGTTCCTTTAATGTTAGGGGCTCCGGATATATCTTTTCCTCGAATAAATAATTTATCCTTTTGATTATTACCGCCTTCTTTATTTTTGTTGTTTATATCTTCTATAGTTGAGATAGGGGTTGGAGCAGGTTGAACGGTTTATCCTCCTTTAGCTTCTAGAATTGGGCATATGGGAAGTTCAATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGTGCTTCTTCTATTATAGGTGCTGTGAATTTTATTTCTACTATTATTAATATACGATTAATAGGAATAACAATGGAGAAGATCCCTTTATTTGTATGATCGGTTTTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCAGGAGCTATTACTATATTATTGACTGATCGAAATTTTAATACTTCTTTTTTTGACCCTGCTGGAGGTGGAGATCCTATTTTATTTCAACATTTATTTTGATTTTTTG (GenBank accession number OP572102).

Figures

Figure 1. Distribution records of ctenid spiders from Asia in this study. 1. Amauropelma krabi sp. n.; 2. Am. phangnga sp. n.; 3. Am. saraburi sp. n.; 4. Anahita medog sp. n.; 5. An. popa; 6. Bowie fascination; 7. B. ninhbinh sp. n.; 8. B. vinhphuc sp. n.; 9. B. borneo sp. n.; 10. B. engkilili sp. n.; 11. B. sabah sp. n.

Figure 10. Anahita medog sp. n., palp, holotype. a: Prolateral view; b: Ventral view; c: Retrolateral view. DS = distal retrolateral spine, E = embolus, TA = tegular apophysis. Scale bar: 0.2 mm (a-c).

Figure 11. Anahita medog sp. n. a: Paratype female, epigyne, ventral view; b: Same, vulva, dorsal view; c: Holotype male, habitus, dorsal view; d: Same, habitus, ventral view; e: Paratype female, habitus, dorsal view; f: Same, habitus, ventral view. CD = copulatory duct, CO = copulatory opening, FD = fertilisation duct, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 1.0 mm (c-f).