Microparmarion sallehi Wu, Ezzwan & Hamdani, 2023

Schilthuizen, Menno, Berenyi, Simon, Ezzwan, Nurilya Syamimi Muhammad Nazirul, Hamdani, Nur Izzah Amal Afiqah, Wu, Harrison, De Antoni, Luca, Vincenzi, Leonardo, de Gier, Werner, van Peursen, Anthonie D. P., Njunjic, Iva, Delledonne, Massimo, Slik, Ferry, Grafe, Ulmar & Cicuzza, Daniele, 2023, A new semi-slug of the genus Microparmarion from Brunei, discovered, described and DNA-barcoded on citizen-science ' taxon expeditions' (Gastropoda, Stylommatophora, Ariophantidae), Biodiversity Data Journal 11, pp. 101579-101579 : 101579

Microparmarion sallehi Wu, Ezzwan & Hamdani sp. n.

Materials

Type status: Holotype. Occurrence: catalogNumber: UBDM.7.00152 ; recordedBy: Simon Berenyi; individualCount: 1; lifeStage: adult; occurrenceID: E8F80EB3-496A-55DB-AB38-9B8F961214A7; Taxon : scientificName: Microparmarion sallehi; Location : country: Brunei; stateProvince: Temburong District; locality: Kuala Belalong Field Studies Centre , Ashton trail ; verbatimElevation: 100 m; decimalLatitude: 4.547; decimalLongitude: 115.157; georeferenceProtocol: GPS; Identification : identifiedBy: Menno Schilthuizen ; dateIdentified: 2022; Event : eventDate: 26/09/2018; Record Level: language: en; basisOfRecord: PreservedSpecimen Type status: Paratype. Occurrence: catalogNumber: RMNH.MOL.328207 ; recordedBy: Menno Schilthuizen; individualCount: 1; lifeStage: juvenile; occurrenceID: DABF18BA-CA1A-5E23-8436-C2902ACB3909; Taxon : scientificName: Microparmarion sallehi; Location : country: Brunei; stateProvince: Temburong District; locality: Ulu-Ulu Resort Helipad ; verbatimElevation: 100 m; decimalLatitude: 4.555; decimalLongitude: 115.153; georeferenceProtocol: GPS; Identification : identifiedBy: Menno Schilthuizen ; dateIdentified: 2022; Event : eventDate: 14/10/2022; Record Level: language: en; basisOfRecord: PreservedSpecimen Type status: Paratype. Occurrence: catalogNumber: TxEx-BR2202 ; recordedBy: Iva Njunjić; individualCount: 1; lifeStage: juvenile; occurrenceID: E66016F3-86E1-5F46-AC2C-6C3D1535162D; Taxon : scientificName: Microparmarion sallehi; Location : country: Brunei; stateProvince: Temburong District; locality: Kuala Belalong Field Studies Centre , Ashton trail ; verbatimElevation: 100 m; decimalLatitude: 4.547; decimalLongitude: 115.157; georeferenceProtocol: GPS; Identification : identifiedBy: Menno Schilthuizen ; dateIdentified: 2022; Event : eventDate: 16/10/2022; Record Level: language: en; basisOfRecord: PreservedSpecimen Type status: Paratype. Occurrence: catalogNumber: TxEx-BR2203 ; recordedBy: Iva Njunjić; individualCount: 1; lifeStage: juvenile; occurrenceID: 82288ED8-A035-581D-B1CC-3EC3838F2953; Taxon : scientificName: Microparmarion sallehi; Location : country: Brunei; stateProvince: Temburong District; locality: Kuala Belalong Field Studies Centre , Ashton trail ; verbatimElevation: 100 m; decimalLatitude: 4.547; decimalLongitude: 115.157; georeferenceProtocol: GPS; Identification : identifiedBy: Menno Schilthuizen ; dateIdentified: 2022; Event : eventDate: 16/10/2022; Record Level: language: en; basisOfRecord: PreservedSpecimen Type status: Other material. Occurrence: catalogNumber: TxEx-BR1901 ; recordedBy: Taxon Expeditions; individualCount: 1; lifeStage: juvenile; occurrenceID: 4B28FD4F-841C-5A38-A713-632C00FB1C1B; Taxon : scientificName: Microparmarion sallehi; Location : country: Brunei; stateProvince: Temburong District; locality: Kuala Belalong Field Studies Centre , Ashton trail ; verbatimElevation: 100 m; decimalLatitude: 4.547; decimalLongitude: 115.157; georeferenceProtocol: GPS; Identification : identifiedBy: Menno Schilthuizen ; dateIdentified: 2022; Event : eventDate: 30/09/2019; Record Level: language: en; basisOfRecord: PreservedSpecimen

Description

Preserved specimens (Figs 1 , 2 ). Ethanol-preserved juveniles are 6-11 mm in length. On the dorsal and lateral sides excluding the foot and its margins, there is a blackish-brown mottled pattern on a pale white background. The foot is pale white with a smooth surface, with the lateral head margins of the foot having a blackish-brown mottled pattern; the rest of the margins remain pale white. Three distinct longitudinal dark brown bands run on the head, one starting posterior of each eye tentacle and the third dorsomedially in between these two, starting level with them. These three bands end at the level of the pneumostome. In between the rim of the shell and when the left and right mantle lobes are pulled back, there can be either blackish-brown mottled patterns or stripes that encircle the shell. An unpigmented peripheral ridge runs from the left frontal margin of the mantle, immediately behind the left eye tentacle, circles the shell, where, on the caudolateral side of the shell, it throws off a short side branch that leads dorsad to the mantle edge; the main branch of the keel continues and ends on the right at the pneumostome. The genital opening is visible on the right lateral side behind the head and appears as a circular pore. In the adult, 29 mm long, the colour patterns are similar to those in the juveniles, but the contrasts are much reduced and colours range from pale light brown to reddish-brown.

Living specimens (Fig. 3 ). Living specimens differ from preserved ones in size (in ethanol, the animals contract to 50% of their live extended length) and in colouration, as follows. The general colouration for the dorsal side and ventral side is blackish-brown and pale white, respectively. In juveniles, the foot is pale white with a smooth surface, with the lateral frontal margins of the foot having a blackish-brown mottled pattern and the rest of the margins remaining pale white. In adults, this blackish-brown mottled pattern can not only extend to the frontal margins of the foot, but also the caudal margins. The mantle carries a blackish-brown mottled pattern on a pale background, with a yellowish-white streak extending from the left mantle lobe to the mantle itself. In adults, the pattern on the mantle largely disappears and is replaced by an ochre colouration, with the streak being reduced or becoming non-existent. The left and right mantle lobes in both adults and juveniles meet along a curved slit. Anterior to the mantle in juveniles, two longitudinal black stripes on the head that start caudally at the base of the eye tentacles extend towards the anterior part of the mantle. In addition, a dorso-medial black line on the head in between the eye tentacles also extends caudally towards the mantle. In juveniles, all four tentacles may be reddish- or greyish-brown (though the oral tentacles can be pale as well), but in the adult, this is reduced to an ochre brown, with the oral tentacles becoming paler. The caudal horn, dorsal to the caudal end of the foot, is pointed caudally and slightly extends beyond the length of the foot. In the adult, the caudal horn can be pointed or curved downwards. In juveniles, the colouration of the tail is a greyish-brown, with a dark brown mottled pattern. In the adult, this high-contrast colouration is replaced with a general browner colouration, though some mottling remains.

Shell

Juvenile shells (Fig. 4 a) are oval, 3.5-6.0 mm long and 2.0-4.0 mm wide, of a transparent yellowish-green colouration, slanting towards the left lateral side, which causes a bulge on the left side. The surface is smooth and developmental rings are visible. In lateral view, the shell rim is flattened while the shell smoothly curves into a round bump on top. Whorls are not discernible: the shell consists of a single, oval dish. The adult shell (Fig. 4 b) is 11 mm long and 8 mm wide, fingernail-like and similarly displays several darker-coloured growth bands, but no traces of whorls.

Genitalia

The penis, at around 5 mm from the connection with the vagina, bends back upon itself in a 2-mm-long loop (Fig. 5 ). The looped part is of the same width as the proximal part of the penis. Distally, the looped part narrows abruptly and is enveloped by a muscular extension of the penis; the epiphallus, 2.2 mm long, is visible as an initially relatively thick, but then narrowing, sinuous tube inside this muscular sheath. The penis retractor muscle appears to connect at the basis of the epiphallus. Terminally, the epiphallus gives way to the vas deferens. At 4 mm from the genital opening, the gametolytic sac emerges from the vagina. The dart sac is ca. 5 mm long and connects to the vagina at the opposite side from the penis. It is connected to the 10-mm-long, 2-mm-wide dart sac gland by a narrow looped stalk.

DNA barcode

The COI DNA barcode of the holotype (UBDM.7.00152; BOLD TXEX074-23) is as follows:

5 ’AACATTATATATAATTTTTGGAGTTTGATGTGGTATAGTAGGAACAGGCTTATCATTATTAATTCGATTAGAATTAGGTACAGCTGGTGTATTACTTGATGATCATTTTTTTAATGTAATTGTGACTGCACATGCATTTGTAATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGAATAGTTCCTTTATTAATTGGAGCTCCAGATATAAGTTTTCCACGAATAAATAATATAAGATTTTGATTATTACCTCCTTCATTTGTATTTTTAATTGTTTCTAGTATGGTTGAAGGTGGTGCAGGAACTGGTTGAACAGTTTATCCACCTTTAAGAGGACCAGTAGGACATGCAGGAGCCTCAGTAGATTTGGCTATTTTTTCTTTACATTTAGCAGGTATATCATCTATTTTAGGTGCTATTAATTTTATTACTACTATTTTTAACATACGGTCTTCTGGTATAACTATAGAACGTGTAAGACTATTTGTTTGATCTATTTTAGTAACTGTATTTTTATTACTATTATCTTTACCTGTACTTGCTGGGGCTATTACAATACTTTTAACTGATCGAAATTTTAATACTAGTTTTTTTGATCCTGCTGGAGGAGGAGATCCGATTTTATATCAACATTTATTT3’

Diagnosis

This new species of Microparmarion stands out because of its shell, which, unlike other north Bornean species of the genus, has no discernible whorls. In that sense, it appears to be more closely related to Parmarion , with which it also shares the clearly keeled mantle. However, the genital set-up, with the looped part of the penis, the vas deferens connected terminally to the epiphallus and the unstalked gametolytic sac clearly fits with the Microparmarion genus definition ( Simroth 1893; Vermeulen and Liew 2022). The looped part of the penis, which remains thick until the place where it is enveloped by the muscular sheath, places the species in 'group 2' of Vermeulen and Liew (2022).

Externally similar north Bornean species are M. simrothi Collinge & Godwin-Austen, 1895, M. exquadratus Schilthuizen et al., 2019, and M. convolutus Vermeulen & Liew, 2022. What sets M. sallehi apart from M. simrothi is that the new species lacks M. simrothi 's papillose mantle surface and has partial mottled patterns on the foot margins, whereas in M. simrothi the foot margin has an uninterrupted mottled pattern. The mantle of the new species lacks the uneven, interrupted dark ring close to the periphery of the part of the mantle that covers the shell. In adult M. convolutus , the mantle is smooth, while in the new species, it is covered in low nodules and ripples. The colouration in M. convolutus is whitish, pale orange or pale pink with a slight greyish mottling on the sides and the tail, while the new species is a pale orange as an adult or pale white as a juvenile with a blackish-brown mottled pattern. M. exquadratus , finally, is generally darker in colour: dull orange to pale red with dark brown patterning, while the new species is a pale orange as an adult or pale white as a juvenile with a blackish-brown mottled pattern. M. sallehi has either uninterrupted blackish-brown mottled patterns or horizontal stripes that encircle the shell in juveniles. In adults, these patterns or stripes do not appear. M. exquadratus , on the other hand, has a mantle with an uneven, wide, locally interrupted dark ring surrounding the lumen otherwise coarsely spotted. In live M. exquadratus , the surface of the mantle is covered in small, irregular pustules, whereas in M. sallehi , there are parallel ripples.

In the anatomy, M. sallehi n. sp. differs from all these three similar species by the long, strongly developed looped part of the penis, which is as thick and as long as the proximal part of the penis. In M. simrothi , M. exquadratus and M. convolutus , the looped part is always much thinner or differently shaped.

Etymology

The species epithet is a masculine genitive and honours the supervisor of the Kuala Belalong Field Studies Centre, Mr. Md Salleh Abdullah Bat, who recently retired. The taxon expedition, during which the species was described, was the last group he hosted before retirement. The name won the winning number of votes out of seven options during a voting session in which all participants of the 2022 expedition took part.

Ecology

This species is generally crepuscular and nocturnal. It was seen at night and in the morning after rain, crawling underneath leaves of saplings and on vines, in both primary and secondary forest.

Figures

Figure 1. Microparmarion sallehi, n. sp., photographs of preserved holotype specimen (UBDM. 7.00152), Kuala Belalong Field Studies Centre, Brunei Darussalam; a dorsal view; b left lateral view; c right lateral view.

Figure 2. Microparmarion sallehi, n. sp., photographs of preserved paratype specimen (TxEx-BR 2203), Kuala Belalong Field Studies Centre, Brunei Darussalam; a dorsal view; b left lateral view; c right lateral view.

Figure 3. Microparmarion sallehi, n. sp., photographs of living individuals, Kuala Belalong Field Studies Centre, Brunei Darussalam; a holotype, UBDM. 7.00152, right lateral view; b holotype, UBDM. 7.00152, left lateral view; c paratype, TxEx-BR 2201, right dorsolateral view.

Figure 4. Microparmarion sallehi, n. sp., dorsal views of shells; a pencil drawing of the shell of a paratype specimen (TxEx-BR 2201), Helipad, Ulu-Ulu Resort, Brunei Darussalam; b photograph of the shell of the holotype specimen (UBDM. 7.00152), Kuala Belalong Field Studies Centre, Brunei Darussalam.

Figure 5. Microparmarion sallehi, n. sp., preserved holotype specimen (UBDM. 7.00152), Kuala Belalong Field Studies Centre, Brunei Darussalam; a dissected genitalia; b detail of penis and epiphallus.