Giraffa tippelskirchi Matschie, 1898
publication ID |
https://doi.org/10.5852/ejt.2020.703 |
publication LSID |
lsid:zoobank.org:pub:4D9170AC-775A-4DBB-9F04-87FF91AF5336 |
persistent identifier |
https://treatment.plazi.org/id/EE266764-FFB3-2562-FDDD-FC1AEF27F9E0 |
treatment provided by |
Valdenar (2020-08-18 13:00:12, last updated 2020-08-18 13:55:09) |
scientific name |
Giraffa tippelskirchi Matschie, 1898 |
status |
|
Giraffa tippelskirchi Matschie, 1898
Diagnosis
Faint or strongly stellate form of the patches, absence of occipital horns, seven ES in the UBN2 intron: 48 dA, 209 iCATAATATATTTAATATATTTAATATTTAATAA, 243 T=>A, 318 G =>C, 332 T=>G, 504 A=> C, 623 C=>T
Type material
Lectotype (here designated)
TANZANIA • 1 specimen (skull and skin); Lake Eyasi ; ZMB-084951 .
Distribution
Kenya, Tanzania (lectotype), Zambia.
Remarks
Matschie (1898) mentions two different specimens as syntypes, but the second cannot be found in the collection catalogue and might be considered as lost.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |
1 (by valdenar, 2020-08-18 13:00:12)
2 (by valdenar, 2020-08-18 13:54:55)
3 (by ExternalLinkService, 2020-08-18 13:55:09)
4 (by ExternalLinkService, 2020-08-18 14:05:36)
5 (by valdenar, 2020-08-18 14:10:17)
6 (by ExternalLinkService, 2020-12-17 08:12:45)
7 (by ExternalLinkService, 2021-09-19 03:40:26)
8 (by plazi, 2023-10-31 21:04:33)
9 (by ExternalLinkService, 2023-11-01 13:18:04)
10 (by carolina, 2023-11-21 23:52:30)
11 (by juliana, 2023-11-24 12:12:34)