Polygonus pardus Grishin, 2023
publication ID |
https://doi.org/ 10.5281/zenodo.7710103 |
DOI |
https://doi.org/10.5281/zenodo.7710123 |
persistent identifier |
https://treatment.plazi.org/id/DD62E766-2A6F-725A-FF36-C10EFB95FE4E |
treatment provided by |
Felipe |
scientific name |
Polygonus pardus Grishin |
status |
sp. nov. |
Polygonus pardus Grishin , new species
https://zoobank.org/ 5D5511FC-2D68-46F5-AD2E-062F10DD20D4
( Fig. 31 View Figure 31 part, 32, 33a, 34)
Definition and diagnosis. Phylogenetic analysis of genomic sequences reveals that Polygonus savigny Latreille, [1824] (type locality not given, possibly in Southeast Brazil) is not monophyletic, and Mexican populations currently assigned to P.savigny ( Fig. 31 View Figure 31 red) form a clade sister to Polygonus punctus E. Bell and W. Comstock, 1948 (type locality St. Vincent) ( Fig. 31 View Figure 31 blue) rather than Brazilian P.savigny ( Fig. 31 View Figure 31 green). Therefore, the red clade is not P.savigny but, because there are no names available for these populations, represents a new taxon closely related to P. punctus . Fst / Gmin statistics for the comparison of the two taxa are 0.22/0.02, but their COI barcodes differ by 0.5% (3 bp), although consistently in all specimens ( Fig. 31b View Figure 31 ). Due to genetic differentiation, the new taxon is a species. It differs from its closest relative P. punctus ( Fig. 33b View Figure 33 ) by larger hyaline spots on the forewing ( Fig. 32 View Figure 32 , 33a View Figure 33 ), in particular, the spot in the cell CuA 1 -CuA 2 is nearly square, not narrower and rectangular as in P. punctus . Compared to a more distant relative P. savigny ( Fig. 33c View Figure 33 ), dorsal hindwing spots are usually defined weaker, not as contrasting against ground color. In male genitalia, the valva is narrower (in lateral view), not broadening towards vinculum and the ampulla is more concave. These phenotypic differences are subtle, and the new species is best diagnosed by DNA. A combination of the following base pairs is diagnostic in nuclear genome: aly3507.2.1:C65T,aly3507.2.1:G70A, aly925.11.10:C284G, aly5411.1.24:G60C, and aly490.12.1:A4311C, and COI barcode: T169C, T283C, and T412T(not C).
Barcode sequence of the holotype. Sample NVG-14111F12, GenBank OP762109, 658 base pairs:
AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGTACATCTCTTAGATTACTAATTCGAACAGAATTAGGAACCCCTGGAT CTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCCATTATAATTG GAGGATTTGGTAATTGATTAGTTCCTCTTATACTTGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGACTATTA CCCCCTTCTTTAACCCTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCAGGTACAGGTTGAACAGTTTACCCCCCTCTTTCAGCTA ATATTGCTCATCAAGGTTCTTCAGTAGATTTAGCAATTTTTTCCTTACATTTAGCTGGAATTTCCTCTATTTTAGGAGCTATTAATTTTA TTACTACAATTATTAATATACGAATTAGAAATTTATCTTTTGATCAAATACCTTTATTCGTTTGAGCTGTTGGAATTACAGCTTTATTATT ACTTCTTTCTTTACCTGTATTAGCAGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACTTCCTTTTTTGATCCTGCAGGAGG AGGAGATCCTATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the Texas A&M University Insect Collection, College Station, Texas, USA ( TAMU), illustrated in Fig. 32 View Figure 32 , 34 View Figure 34 bears the following six rectangular labels, five white: [TEXAS: | HIDALGO COUNTY | McAllen, Valle], [coll. | 1-IX-1972 | W. W. McGuire], [ Polygonus | manueli ♂ | Det. 7 | W. W. McGuire], [ HESPERIIDAE , | Pyrginae: | Polygonus manueli | manueli Bell and | W.P. Comstock, 1948 | det. R.O. Kendall | ♂ M. & B. No. 10], [DNA sample ID: | NVG-14111F12 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Polygonus | pardus Grishin ]. Paratypes: 3♂♂ and 1♀: Mexico: 1♀ NVG-15116H12 Sinaloa, MX Hwy 40, near Jct. of Mex 15, 400’, 30-Aug-1967, R. W. Holland leg. [ CSUC]; 1♂ NVG-5028 Oaxaca, Isthmus, road to San Miguel Chimalapa, ca. 100 ft, 13-Aug-1992, J. Kemner leg., genitalia NVG151101-79 [ USNM]; 1♂ NVG-5029 Yucatan, Piste, 15-Aug-1962, E. Welling leg., genitalia NVG151101-80 [ USNM]; 1♂ NVG-15099F01 Chiapas, 10 mi NW Bonampak, 1-Aug-1988, J. Kemner leg. [ CMNH].
Type locality. USA: Texas, Hidalgo Co., McAllen.
Etymology. There is Polygonus leo , and now there will be Polygonus pardus , two related species and two parts of the word leopardus. More, its brown-spotted tawny hindwing lives up to the name, which is a masculine noun in apposition.
English name. Spotted polygon.
Distribution. From the Lower Rio Grande Valley in South Texas, USA to Costa Rica.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |