Urbanus (Urbanus) rickardi Grishin, 2023

Zhang, Jing, Cong, Qian & Grishin, Nick V., 2023, Thirteen new species of butterflies (Lepidoptera: Hesperiidae) from Texas, Insecta Mundi 2023 (969), pp. 1-58 : 9-11

Urbanus (Urbanus) rickardi Grishin , new species

https://zoobank.org/ 68326A84-5C57-42DA-B975-8B33D2A99386

( Fig. 5 part, 6, 7)

Definition and diagnosis. Sister to Urbanus pronus Evans, 1952 (type locality Ecuador: Ambato). In both nuclear and mitochondrial genome trees ( Fig. 5 orange), separated from closely clustered South American U. pronus ( Fig. 5 blue) specimens by a gap, and its COI barcodes differ from them by 2.1% (14 bp). Therefore, proposed as a species-level taxon. Phenotypically, similar to U. pronus and keys to it in Steinhauser (1981), and to C. 13.5 in Evans (1952) (wrong genitalic sketch, see Steinhauser 1981: 22), but the overscaling at the wing bases and body above is greener, less extensive and yellower towards hindwing tail, disappearing more gradually towards it ( Fig. 6 ); in male genitalia ( Fig. 7 ), the caudal end of the valva is less round and longer, the uncus arms are farther apart especially near the base, the aedeagus is terminally narrower and more extended. Because the species is confidently known from one specimen, the extent of variation in these phenotypic characters has not been studied. Therefore, confidently identified by genotype: in DNA, a combination of the following base pairs is diagnostic in nuclear genome: aly320.19.2:G97T, aly5719.2.5:A132C, aly 1188.10.5:C120G, aly100186.1.3:C54C(not T), aly5719.2.5:G144G(not C), and aly967.3.5:A84A (not G), and COI barcode: T106C, T193C, A208G, A253G, T263T(not C), A316G, T397T(not C), and A477G.

Barcode sequence of the holotype. Sample NVG-14111G01, GenBank OP762099, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGAT CTTTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCTCACGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGG AGGATTTGGTAACTGACTAGTACCTTTGATAATAGGAGCCCCTGATATAGCTTTCCCCCGTATAAATAACATGAGATTTTGATTATTAC CCCCTTCTTTAACTTTATTAATTTCAAGAAGAATTATTGAAAATGGGGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAA TATTGCTCATCAAGGAGCCTCTGTTGATTTAGCAATTTTTTCCCTTCATCTTGCTGGAATTTCATCAATTCTTGGAGCTATTAATTTTA TTACAACAATTATTAATATACGAATTAATAGATTATCTTTTGATCAAATACCATTATTTGTATGAGCTGTAGGAATTACAGCATTATTATT ATTACTTTCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTTTTTGACCCTGCTGGAGG AGGGGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the Texas A&M University Insect Collection, College Station, Texas, USA ( TAMU), illustrated in Fig. 6 , 7 , bears the following six rectangular labels, five white: [TEXAS: | HIDALGO COUNTY | Tex Hwy 1016 S of | Mission nr Madero | TEXAS:], [coll. | 19 Oct 1971 | Michael A. Rickard], [ Urbanus | pronus ♂ det | James Scott], [ HESPERIIDAE , | Pyrginae: | Urbanus pronus | Evans, 1952 | ♂ det. R.O. Kendall | M. & B. No. 25],[DNA sample ID: | NVG-14111G01 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Urbanus | rickardi Grishin ].

Type locality. USA: Texas, Hidalgo Co., Urban Road No. 1019 S of Mission, near Madero.

Etymology. The name honors Michael A. Rickard, the collector of the holotype, and contributor of many remarkable butterfly records from the Lower Rio Grande Valley in Texas ( McGuire and Rickard 1976; Rickard 2010; Rickard and Grishin 2010) among his many other contributions to our knowledge of Texas butterflies. The name is a noun in the genitive case.

English name. Rickard’s longtail.

Distribution. Currently known only from the holotype from the Lower Rio Grande Valley in South Texas as a possible stray from Mexico.

Figures

Figure 5. Trees of selected Urbanus (Urbanus) species constructed from protein-coding regions in a) nuclear and b) mitochondrial genomes:U. rickardi sp. n. (orange), U. pronus (blue), U. alva (purple), U. viterboana (green), U. oplerorum sp. n. (red), and U. bernikerni (cyan) among their relatives (black). Primary type specimens are labeled in magenta. See Fig. 1 legend for other notations.

Figure 6. Holotype of Urbanus (Urbanus) rickardi sp. n. dorsal (left) and ventral (right) views, data in text.

Figure 7. Male genitalia of Urbanus (Urbanus) rickardi sp. n. holotype in situ (data in text) in different views. a) dorsal, caudal end up, b) right dorsolateral, c) right lateral. Genitalia were dry-dissected and right valva removed (likely by James Scott).