Megaselia sepsioides Hartop, 2019

Srivathsan, Amrita, Hartop, Emily, Puniamoorthy, Jayanthi, Lee, Wan Ting, Kutty, Sujatha Narayanan, Kurina, Olavi & Meier, Rudolf, 2019, Rapid, large-scale species discovery in hyperdiverse taxa using 1 D MinION sequencing, BMC Biology 17, pp. 1-20 : 10

publication ID

https://doi.org/ 10.1186/s12915-019-0706-9

DOI

https://doi.org/10.5281/zenodo.3716972

persistent identifier

https://treatment.plazi.org/id/9A7387AB-8E03-FFCC-CE90-FF5146E58828

treatment provided by

Plazi

scientific name

Megaselia sepsioides Hartop
status

sp. n.

Megaselia sepsioides Hartop sp. n.

urn:lsid:zoobank.org:pub:ED268DF2-A886-4C31-A4FB-6271C382DECE

DNA barcode for UGC0005996 (GenBank accession: MN403533 View Materials )

actttatattttatttttggagcttgagctggaatagtaggtacttccttaagaatc ataattcgtgctgaattaggacacccaggagcacttattggtgatgaccaaatttat aatgtgattgttactgcacatgcttttattataattttttttatagtaatacctattataa taggaggttttggtaattgacttgtacctttaatattaggagccccagatatggcatt ccctcgaatgaataatataagtttttgaatattacctccttctttaactcttttattagc cagaagtatagtagaaaatggagctggaactggttgaacagtttatcctcctttatc ttctagaatcgctcatagtggagcttctgttgatttagcaattttctctcttcatttag ctggaatttcatctattttaggagctgtaaattttattacaacaattattaatatacga tcatcaggtattacatttgaccgaatacctctatttgtttgatctgtaggtattacag ctttattgctactcttatcacttcctgttttagctggtgctattacaatactattaaca gaccgaaattttaatacttcattttttgacccagcaggaggaggagatccaatttta taccaacatttattc.

Diagnosis

Well characterized by the following combination of characters: with unique semi-circular expansion with modified peg-like setae on the forefemur ( Fig. 5b View Fig ), hind tibia strongly constricted ( Fig. 5d, e View Fig ), and abdomen narrow and elongate. Three haplotypes were examined;

variations in setation were observed between the main cluster and two haplotypes ( Figs. 6 View Fig and 7). Only single specimens of the two distinct haplotypes were available; more specimens would be necessary to determine if these are eventually recognized as distinct species or fall within a continuum of intraspecific variation.

Material examined

Holotype. ♂, UGANDA: Kamwenge, Kibale National Park (00° 33 ′ 54.2 ″ N 30° 21 ′ 31.3 ″ E, 1530 m), iiixii.2010, Olavi Kurina & Swaibu Katusabe (LKCNHM UGC0005996). GoogleMaps

Paratypes. 7 ♂, UGANDA: Kamwenge, Kibale National Park (00° 33 ′ 54.2 ″ N 30° 21 ′ 31.3 ″ E, 1530 m), iii-xii.2010, Olavi Kurina & Swaibu Katusabe (LKCNHM: UGC0012899, UGC0012244, UGC0012568, UGC0003003, UGC0005864, UGC0012937, UGC0012971) GoogleMaps .

Distribution

Known from a single site in Kibale National Park, Uganda.

Biology

Unknown.

Etymology

Name suggested by Yuchen Ang for the sepsid-like ( Diptera : Sepsidae ) foreleg modification.

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Diptera

Family

Phoridae

Genus

Megaselia