Vicia sativa

Dobosz, Renata, Flis, Łukasz, Bocianowski, Jan & Malewski, Tadeusz, 2023, Effect of Vicia sativa L. on Motility, Mortality and Expression Levels of hsp Genes in J 2 Stage of Meloidogyne hapla, Journal of Nematology 55 (1), pp. 1-17 : 10-11

Effect of V. Sativa seeds on the expression levels of HSp genes in J 2 stage

The known HSP gene sequences in CaenORHaBdiTiS eleganS (Maupas, 1900) were the reference for the detection and identification of homologous HSP genes in M. HaPla. Genome sequence and annotation have been imported from the WS 246 release of WormBase ( Table 4). Sequences of the designed primers located on different exons of the MH – HSP 90, MH – HSP 1, MH – HSP 60, MH – HSP 43 and MH – HSP 12.3 genes are listed in Table 5.

Immersing the nematodes in the V. SaTiva seed diffusate (cv. Ina) resulted in increased expression of three HSP genes: MH – HSP 90, MH – HSP 1, and MH – HSP 43. The most significant changes occurred in the expression of the MH – HSP 43 gene. MH – HSP 43 gene expression was 2.6 compared to the control, 1.0. Lower expression occurred in the the gene MH – HSP 1 = 2.2 and gene MH – HSP 90 = 1.8. In the MH – HSP 60 (0.9) and MH – HSP 12.3 (0.2) genes, no increase in expression compared to the control was observed.

With the expression level increase of 1.8 and 1.7, respectively, the MH – HSP 43 gene and the MH – HSP 1 gene displayed the greatest difference in expression between the nematodes immersed in the diffusate (paralyzed) and those transferred from the diffusate to water (those nematodes regained their ability to move).

The expression level of tested MH – HSP 90 (0.8), MH – HSP 1 (0.5), MH – HSP 60 (0.6), MH – HSP 43 (0.8), and

Primer Seq 5´to 3´- Forward MH-HSP 90 TCTCTGATGATGAGGCTGAAGA