Orasema minutissima, Howard

Heraty, John M., Rogers, D. Valle, Johnson, M. Tracy, Perreira, William D., Baker, Austin J., Bitume, Ellyn, Murray, Elizabeth & Varone, Laura, 2021, New record in the Hawaiian Islands of Orasema minutissima (Hymenoptera: Eucharitidae), an ant-parasitic wasp and a potential biocontrol agent against the Little Fire Ant, Wasmannia auropunctata (Hymenoptera: Formicidae), Bishop Museum Occasional Papers 137, pp. 7-18: 9-17

publication ID

http://doi.org/10.5281/zenodo.4639493

publication LSID

lsid:zoobank.org:pub:urn:lsid:zoobank.org:pub:A423690D-7D97-492A-B49D-F58B550A1884

DOI

http://doi.org/10.5281/zenodo.4639545

persistent identifier

http://treatment.plazi.org/id/6178723A-FFD1-FFD7-DC94-FDE0FD958D09

treatment provided by

Donat

scientific name

Orasema minutissima
status

 

Sampling. The first observation of O. minutissima  

was made by DVR in Hilo using Yellow Pan Traps (YPT) that consisted of a yellow plastic bowl [i.e., 13.5 oz (0.4 liter), 7" × 1 ¾" (17.5 cm × 4.5 cm)], with water and a few drops of non-scented liquid soap, that was placed on the ground. Similar YPT traps were used by MTJ and EB at Hilo and the Keauohana Forest Reserve, two sites known to be infested by Wasmannia   . WDP had been monitoring several sites in Hawai‘i ( Fig. 2 View Fig ), Maui, and O‘ahu as part of a separate insect survey project. On Maui and O‘ahu, Wasmannia   was not present at either site being sampled, but Pheidole   were present. His YPTs consisted of yellow 8 ounce (0.24 liter) plastic “shave ice” flower cups, readily available at local restaurant supply stores and online, filled with water and about 5 ml of yellow colored dish soap; traps were placed in the field for two weeks and the specimens air-dried. Bowl size (larger or smaller) is not likely to affect monitoring for presence or absence of O. minutissima   . WDP also sampled with Yellow Sticky Board Traps ( YSBT) consisting of 10" × 12" (25.40 cm x 30.48 cm) cards from HTG Supply (htgsupply.com; Callery, PA) cut into 10" × 3" (25.4 cm × 7.5 cm) strips and hung from branches approximately 3–4 ft (0.91–1.22 m) above ground at each field location ( Fig. 2 View Fig ). After two weeks, the YSBTs were replaced with new traps and specimens stuck to the exposed traps were removed using Aliphatic Naphtha (Crown Brand V.M.&P. NAPHTHA ®), soaked in same solutions for about one hour until all adhesive materials were dissolved, and then air-dried. Specimens of Orasema   were either airdried or chemically dried from ethanol using HMDS ( Heraty & Hawks 1998) and then point-mounted and deposited in either the Entomology Research Museum, University of California, Riverside, CA ( UCRC _ENT) or the Bernice P. Bishop Museum, Honolulu, HI ( BPBM) (Appendix). Individuals were assigned a unique barcode and databased in the Heraty lab FileMaker Pro database.

Sequencing. Specimens from 95% ethanol were extracted using DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA, USA) with 1 μL RNase A added after incubation. PCR products were purified with DNA Clean & Concentrator-5 kits (Zymo Research, Irvine, CA, USA). PCR product concentrations were determined using Nanodrop 2000c (Thermo Scientific, Waltham, MA, USA). Two regions of ribosomal DNA were PCR amplified individually and Sanger-sequenced with the following primer sequences: 28S D2 rDNA (D2-F: CGGGTTGCTTGAGAGTGCAGC; D2-Ra: CTCCTTGGTCCGTGTTTC) and ITS2 (ITS2-F: TGTGAACTGCAGGACACATG; ITS2- R 2: TCTCGCCTGCTCTGAGGT). The following thermocycler protocol was used: initial denaturization: 94 °C 3 min., 34 cycles Table 1. Orasema minutissima   specimens sequenced.

specimen id 28S-D2 ITS2 Country size class D number

235958 KY349472 View Materials * MW575764 View Materials Brit. Virgin Islands small 0424  

235964 KY349465 View Materials * MW575761 View Materials St. Lucia small 0437  

235966 KY349458 View Materials * MW575757 View Materials Dominica medium 2766  

235967 — identical Dominica medium 2765  

235968 KY349457 View Materials * MW575758 View Materials Dominica medium 2764  

235969 KY349463 View Materials * identical Dominica small 2763  

235970 KY349462 View Materials * MW575760 View Materials Dominica small 2762  

271392 KY349464 View Materials * MW575762 View Materials Dominica small 2830  

271393 KY349459 View Materials * identical Dominica medium 2831  

271395 KY349456 View Materials * MW575756 View Materials Dominica large 2833  

412118 KY349466 View Materials * identical Trinidad small 3800  

412119 KY349467 View Materials * MW575763 View Materials Trinidad small 3801  

412127 KY349469 View Materials * identical Trinidad small 3809  

412131 KY349471 View Materials * identical Trinidad small 3814  

412132 KY349470 View Materials * — Trinidad small 3810  

447074 KY349473 View Materials * — Colombia small 4207  

447075 KY349455 View Materials * MW575755 View Materials Colombia small 4208  

456205 identical identical Puerto Rico small 2808  

468543 MW357878 View Materials MW357873 View Materials Hawai‘i small 6943  

468544 MW357879 View Materials identical Hawai‘i small 6944  

28S-D2 GenBank accession numbers marked by an asterisk were used in Burks et al. (2018); ITS2 accessions are all new. Specimen ID numbers are associated with a prefix UCRC _ENT00 and deposited in UCRC, with full collection data presented in Appendix 1. D numbers are the DNA voucher codes. Identical refers to sequences that were captured but not deposited in GenBank.

(94 °C 1 min.; 55 °C 1 min., 72 °C 1 min.), final extension: 75 °C 7 min. PCR samples were sent to Retrogen Inc (San Diego, CA, USA) for Sanger sequencing on an Applied Biosystems 3730xl DNA Analyzer. Deposition of molecular vouchers is indicated in the Material Examined sections. GenBank accession numbers are listed in Table 1.

Measurements. To investigate the different size classes within O. minutissima   and infer the ant host, measurements were taken for 31 specimens of the total body length (anterior margin of head to apex of gaster) and fore wing length (apex of humeral plate to most distal margin of wing membrane). For specimens from Hawai‘i, all of the small specimens were measured from material that was dried using the HMDS method; the two larger specimens were air-dried but this appeared to have minimal impact on body length. Identification numbers for specimens measured are UCRC _ENT00422315–16, 422320, 468555–67, 468588 (see Appendix for details). Measurements of the Neotropical material included specimens of three size classes (small, medium, large) from across the range of O. minutissima   , including the British Virgin Islands, Colombia (Gorgona Island), Dominica, Puerto Rico, and Trinidad (Appendix); all of these specimens were dried with HMDS. For the Neotropical specimens, we chose only material that had been sequenced for either 28S-D2 or ITS2 (all with identical sequences) to guarantee that they were all forms with the identical haplotype of O. minutissima   .

RESULTS AND DISCUSSION

Distribution in Hawai‘i

To date, O. minutissima   has only been collected in the vicinity of Hilo on the island of Hawai‘i at or near sites 5, 6, 8, 10 and 13 despite continuous trapping at the other sites ( Fig. 2 View Fig , Appendix). Orasema minutissima (Howard)   was first discovered on the island of Hawai‘i near Hilo in October 2019 ( Fig. 1 View Fig ) using yellow pan traps (YPTs, Fig. 1C View Fig ). Subsequent sampling in September 2020 at two sites on Hawai‘i Island by MTJ found O. minutissima   in at least half of 24 YPTs at one site and in most of 10 traps at another, with as many as 10 wasps collected in an individual trap, suggesting that the species is well established ( Fig. 1D View Fig ). Additional collections made during a survey initiated across Hawai‘i in April 2019 using yellow sticky board traps ( YSBT) and a different type of YPT recovered O. minutissima   at 5 out of 17 sites where Wasmannia   was also present ( Fig. 2 View Fig ). Of the sites where no Orasema   were collected, only site 7 (Hilo) and 17 (Whittington Beach Park) are low enough in elevation to also have Wasmannia   ; the other sites with no Orasema   are likely too high (> 1800 m) to have Wasmannia   . From this limited sampling, it is unclear if the Orasema   is distributed only in eastern Hawai‘i, or if it may be more widespread across the island. Mostly females have been recovered, but one male was sampled on a YSBT at site 8. Sampling using both YPTs and YSBTs failed to recover these wasps from either O‘ahu or Maui, suggesting that it is established only on the island of Hawai‘i, although none of the sites sampled had Wasmannia   present. This is the first record of a eucharitid wasp in the Hawaiian Islands, and its accidental introduction has the potential to offer some form of biological control over the invasive LFA.

Sequencing

Two gene regions, 28S-D2 and ITS2, were sequenced for two of the specimens from Hilo following the protocols and primers outlined in Baker et al. (2020) and Burks et al. (2018). The second ITS2 read for D6944 was not of high enough quality to deposit on GenBank but was identical for the sequence obtained. The 28S-D2 sequences were identical to other specimens of O. minutissima   that have been sequenced from the Caribbean and Colombia (Gorgona Island) ( Burks et al. 2018), and for the ITS2 obtained in this study ( Table 1).

Origin of Orasema minutissima  

There have been no purposeful introductions of this wasp to Hawai‘i. It is most likely that they were imported along with a new accidental importation of Wasmannia   . Given that O. minutissima   is not known to occur in Florida, it is not likely to have come with the initial population from Florida, which was the place of origin proposed by Mikheyev & Mueller (2007) and Foucaud et al. (2010). Thus, a separate introduction of Wasmannia   from one of the localities where it is currently distributed, along with its parasitoid, is inferred. However, given that the current gene regions of the wasp have identical haplotypes across the range of the species, no further inference of origin can be made at this time.

Measurements and size classes

A total of 13 specimens were measured from Hawai‘i and another 18 from various Neotropical islands ( Fig. 3 View Fig ). All but two of the specimens from Hawai‘i fell into the small size morph class, which is associated with parasitism of Wasmannia ( Burks et al. 2018)   . The two larger sized specimens appear to be intermediate in size to the medium and large morphs from the Neotropical material ( Fig. 3 View Fig ). The number of measurements for the Neotropical specimens is meager, but we felt it important to only measure sequenced specimens, as closely related species in the complex can be difficult to separate based on morphology alone ( Burks et al. 2018). Larger samples from the Caribbean support the separation of size classes, but the large and medium classes are rarely sampled. Pupae of the small size class have been found only with with brood of Wasmannia   in the Caribbean. A single pupa of a medium-size morph was recovered from a nest of Pheidole   in Dominica, and in an area where both the medium and large morph specimens were collected. We assume that the medium and large size classes are associated with different castes of Pheidole   . On Hawai‘i, we assume that the larger size class also indicates an association with Pheidole   ; however, it is also possible that they are developing on the queen brood of Wasmannia   .

Host plants

In Jamaica, Orasema minutissima   have been collected from Chamissoa altissima (Jacq.) Kunth   ( Amaranthaceae   ), Gynerium sagittatum (Аubl.) Beauv.   (Роасеае) and Zapoteca   ? formosa (Kunth) H.M. Herm. ( Fabaceae   ), although no oviposition was observed ( Heraty 1994a; Burks et al. 2018). In Dominica, the small morph has been observed to oviposit on ferns ( Cyathea tenera (J.E. Smith) Moore   , Cyathaceae; Nephrolepis biserrata Schott   , Polypodiaceae   ; Thelypteris opposita (Vahl) Ching   , Thelypteridaceae   ), whereas the larger size morphs preferentially oviposit on a variety of short (6–12" high) broad-leaf plants ( Coccoloba uvifera   L., Polygonaceae   ; Simarouba amara Aublet   , Simaroubaceae   ; miscellaneous Fabaceae   and Rubiaceae   ). Single eggs are deposited into excavations made into the leaf surface by the enlarged ovipositor ( Fig. 1B View Fig ), with the punctures usually surrounded by a brown scarring of the leaf tissue. In east Hawai‘i, egg punctures, eggs and planidia have been found on alien swordfern ( Nephrolepis brownii (Desv.) Hovenkamp & Miyam.   , Polypodiaceae   ) ( Fig. 1E View Fig ), a ground fern with large-lobed fronds ( Microsorum grossum (Langsdorff & Fischer) S.B. Andrews   , Polypodiaceae   ), and strawberry guava ( Psidium cattleyanum Sabine   , Myrtaceae   ) at the Keauohana Forest Reserve site. While the oviposition scars may cause some cosmetic damage when numbers are high, the leaves usually recover as they mature.

Biological control potential

Heraty (1994a) proposed that O. minutissima   was one of the few species that may have an impact as a biological control agent against Wasmannia   . When present, especially in moist island habitats in the Caribbean, O. minutissima   can be extremely common. However, their impact on the ant population numbers has not yet been assessed within an experimental framework. Their purposeful importation as a biological control agent to other islands, especially to islands in the Pacific, has not been implemented. The primary issues for treating this as a coordinated biological control effort lie with the difficulty of transport and a need for quarantining with the capability for continuous rearing to test for negative impacts against native species. With regard to the Hawaiian introduction, there are no native myrmicine ants on any of the Hawaiian Islands, and in any case Oraseminae   are specific only to that ant subfamily ( Murray et al. 2013; Baker et al. 2020). The impacts of cosmetic damage to native vegetation will likely be minimal, but this should be assessed in the future. It will be necessary to sample for presence of the wasp on island locations that have Wasmannia   present to assess the presence and spread of Orasema   . However, O. minutissima   has been discovered at a time where the spread of the parasitoid and its impact on Wasmannia   , and potentially Pheidole   , can be monitored to see if they have any effect on lowering population densities.

Appendix. Material examined for this study.

Hawaiian Material Examined (deposited in UCRC or BPBM, with UCRC _ENT00 code [abbreviated UC]; DNA number = Dxxxx): USA: Hawaiian Islands: Hawai‘i I.: Hilo, 112 m, 19°41'52"N 155°05'44"W, 14-17 Oct 2019, Valle Rogers, along boundary between lawn and forest, YPT, 0406.19 [6♀, BPBM: UC422320 View Materials , UCRC: UC468543 View Materials ( D6943), UC468544 View Materials ( D6943), UC468555–57]. GoogleMaps   Hilo , 108 m, 19°41'56"N 155°05'45"W, 18 Sep 2020, M.T. Johnson, vegetation along outside fence, YPT [23♀, BPBM: UC422386–95, UCRC: UC499508–20]. GoogleMaps   Kalapana, Kaimu, Chain of Craters Road, mi 21, 18 m , 19°21'40"N 154°58'38"W, 28 Nov–12 Dec 2020, W.D. Perreira, YBST [17♀, UCRC: UC4995722–38]. GoogleMaps   Kaumana Dr. , 434 m, 19°40'52"N 155°09'20"W, 28 May–8 Jun 2020, W.D. Perreira, YSBT [1♀, UCRC: UC468563 View Materials (large form)]. GoogleMaps   Kawainui Stream , 65m, 19°49'13"N 155°05'42"W, 26 Oct–9 Nov 2019, W.D. Perreira, YSBT [1♀, UCRC: UC468558 View Materials ]. GoogleMaps   Pahoa District Park , 200 m, 19°29'35"N 154°56'51"W, 29 Feb–14 Mar 2020, W.D. Perreira, YSBT [2♀, BPBM: UC422315–16 (16 = large form)]. GoogleMaps   Pahoa District Park , 200 m, 19°29'35"N 154°56'51"W, 8–22 Jun 2020, W.D. Perreira, YSBT GoogleMaps   [3♀, UCRC: UC468559 View Materials –61]. GoogleMaps   Pana‘ewa Zoo , 35 m, 19°19'16"N 155°04'16"W, 27 Dec–8 Jan 2020, W.D. Perreira, YSBT [40♀ 1♂, UCRC: UC499539–79]. GoogleMaps   Pana‘ewa Zoo , 35 m, 19°19'16"N 155°04'16"W, 8–20 Jun 2020, W.D. Perreira, YSBT [1♀, UCRC: UC468562 View Materials ]. Hwy 130, GoogleMaps   Keauohana For. Res. , 240 m, 19°24'51"N 154°57'08"W, 25 Sep 2020, M.T. Johnson, along forest edge, YPT [10♀, BPBM: UC422317–19, UCRC: UC499501–507] GoogleMaps   .

Neotropical Material Examined (deposited in UCRC, with UCRC _ENT00 code [abbreviated UC], unless otherwise indicated; DNA number = Dxxxx followed by size class:s = small, m = medium, l = large; coordinates in italics estimated from google earth): British Virgin Islands: Tortola: Mt. Sage Nat. Pk. , Sage Mt. , 18°24'14"N 64°39'39"W, 10 Dec–8 Jan 1993, M.A. Ivie & T. Hughes, nr. toilets, flight intercept trap #4 [1♀, UC235958 View Materials ( D0424s)]. GoogleMaps   Colombia: Cauca: PNN Gorgona, El Saman , 5m, 2°58'0"N 78°11'0"W, 6–22 Mar 2001, H. Torres, Malaise trap, M.1476 [1♀, UC447075 View Materials ( D4208 s)]. GoogleMaps   PNN Gorgona, El Saman, 5 m, 2°58'0"N 78°11'0"W, 7–25 May 2001, H. Duque, malaise trap, M.1844 [1♀, UC 447074 View Materials (D4207s)].   Dominica: Central Forest Reserve , 337 m, 15°26'29"N 61°19'40"W, 15 May 2009, J. Heraty, rainforest, sweep, H09-018 [1♀, UC235970 View Materials ( D2762s)]. GoogleMaps   Northern Forest Reserve Sympa trail (upper site) , 390 m, 15°31'55"N 61°21'35"W, 14 May 2010, J. Heraty, H10-016 [3♀, UC271392 View Materials ( D2830s), UC271393 View Materials (D 2831m), UC271395 View Materials ( D 2833l)]. GoogleMaps   Sulphur Springs, pools trail , 290 m, 15°14'21"N 61°20'50"W, 16 May 2009, J. Heraty, rainforest, sweep, H09-019 [2♀, UC235966 View Materials ( D 2766m), UC235967 View Materials ( D 2765m)]. GoogleMaps   Sulphur Springs, pools trail , 290 m, 15°14'21"N 61°20'50"W, 20 May 2009, J. Heraty, rainforest, sweep, H09-025 [2♀, UC235968 View Materials ( D 2764m), UC235969 View Materials ( D2763s)]. GoogleMaps   Puerto Rico: Maricao: Maricao Forest, rd 120 km 17.9 , 18°10'51"N 66°58'48"W, 22 Oct 2002, Gates, rd edge and shrubs, sweep [1♀, UC456205 View Materials (D2808s)]. GoogleMaps   St. Lucia: W.I.: Barre del Isle , 13°52'23"N 60°58'1"W, 2 Mar 2000, L. Masner, forest trail, ss [1♀, UC235964 View Materials D0437s)]. GoogleMaps   Trinidad: Gasparillo, 10°18'57"N 61°25'7"W, 5–15 Nov 1987, R. Borneo , grass/forest edge, malaise trap, ROM 870031 [1♀, ROME: UC364799 View Materials ( D2810s)]. GoogleMaps   Maracas Falls, 190 m, 10°43'28"N 61°24'32"W, 16 Jul 2013, Heraty, forest, swp, H13-044 [2♀, UC412118 View Materials ( D3800s), UC412119 View Materials ( D3801s)]. GoogleMaps   Maracas Falls, 190 m, 10°43'28"N 61°24'32"W, 23 Jul 2013, Heraty & Baker, forest, YPT/PB bait, H13-073 [3♀, UC412127 View Materials ( D3809s), UC412131 View Materials ( D3814s), UC412132 View Materials ( D3810 s)]. GoogleMaps  

YPT

YPT

YBST

YBST

V

Royal British Columbia Museum - Herbarium

CA

Chicago Academy of Sciences

UCRC

University of California, Riverside

BPBM

Bishop Museum

MA

Real Jardín Botánico

R

Departamento de Geologia, Universidad de Chile

UC

Upjohn Culture Collection

ROME

Royal Ontario Museum - Entomology