Lasaia cola Grishin

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 12-13

publication ID

https://doi.org/10.5281/zenodo.16642576

DOI

https://doi.org/10.5281/zenodo.16802270

persistent identifier

https://treatment.plazi.org/id/4D7E87DA-4B73-7205-FDA9-FFFEACF3F872

treatment provided by

Felipe

scientific name

Lasaia cola Grishin
status

 

Lasaia cola Grishin , new species

http://zoobank.org/ 83817CD8-BC22-4AA1-BF5C-7F07CA4DF9D7 ( Figs. 6 View Fig part, 7, 8b)

Definition and diagnosis. Nuclear genome analysis of Lasaia H. Bates, 1868 ( type species Papilio meris Stoll, 1781 ) reveals a clade ( Fig. 6a View Fig red) that is sister to both Lasaia sula Staudinger, 1888 ( type locality in Honduras) ( Fig. 6 View Fig blue) and Lasaia peninsularis Clench, 1972 ( type locality in Mexico: Veracruz) ( Fig. 6a View Fig purple), thus representing a new species. The three species (the new one, L. sula , and L. peninsularis ) are genetically differentiated from each other to a similar degree in the nuclear genome ( Fig. 6a View Fig ) ( Fst 0.37 and 0.44 between the new one and L. sula and L. peninsularis , respectively) but do not strongly differ in the mitochondrial genome ( Fig. 6b View Fig ) and, consequently, also in the COI barcode. The new species differs from its relatives by males having better developed dark spots and dashes, the hindwing with stronger developed dark dashes, similarly to the forewing (weaker than on the forewing or absent dashes in both L. sula and L. peninsularis ), and some specimens having less blue above, greyer, thus somewhat resembling Lasaia maria maria Clench, 1972 ( type locality in Mexico: Jalisco) and Lasaia sessilis Schaus, 1890 ( type locality in Mexico: Veracruz), but are paler and patterned more like L. sula . In male genitalia ( Fig. 8 View Fig ), the transtilla ( McAlpine 1971) is pointed in the middle as in L. peninsularis and not flattened as in L. sula ( Fig. 8 View Fig green arrow 1); lateral lobes of the transtilla are narrower than in L. sula and are more similar to L. peninsularis ( Fig. 8 View Fig green arrow 2), if not smaller; and the scobinate bulla (Clench 1972) ( Fig. 8 View Fig green arrow 3) is more robust than in the other two species. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 2812.5.8:A69 T, cne28857.1.4:G42A, cne28857.1.4:A65G, cne8137.3.6:C54 T, cne8137.3.6:C66 T. The COI barcode does not differ for L. sula . Barcode sequence of the holotype. Sample NVG-23103F05, GenBank PV 549979, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACATCATTAAGTTTATTAATTCGTATAGAATTAGGTATACCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCATTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCCCCATCTTTATTTCTATTAATTTCAAGAAGTATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTTTATCCCCCTTTATCTTCTAATATTGC CCACGGAGGATCCTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCCATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCATTATTCGTATGATCCGTTGGTATTACTGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACAT CTTTTTTTGATCCAGCAGGAGGAGGTGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA ( CMNH), illustrated in Fig. 7 View Fig , bears the following four rectangular labels (1 st handwritten, others printed), three white: [ MEXICO: Colima | Comala 2100 ft. | 1.X.1967 | R.G.Wind], [R.G. Wind, leg. | Gift of F.M.Brown | C.M. Acc. 23123], [DNA sample ID: | NVG-23111F10 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Lasaia cola | Grishin]. Paratypes: 2♂♂ and 1♀ from Mexico, Colima: 1♂ NVG-24079H06 (leg DNA extraction, sequenced), NVG-25014D03 (abdomen DNA extraction and dissection) La Salada, 1000 ft, 4-Jan-1968, Robert G. Wind leg., genitalia NVG250517 -02 ( Fig. 8b View Fig ) [ MGCL] and (no locality details) [ SMF]: 1♂ NVG- 23103F 05 May-1918 and 1♀ NVG- 23103F 06 Oct-1926 .

Type locality. Mexico: Colima, Comala , elevation 2100 ft.

Etymology. The name is formed from the type locality in Col [im] a and is a feminine noun in apposition.

Distribution. Currently known only from Colima in Mexico.

Comment. In Lasaia , valvae are partly (and weakly) sclerotized and are flexible, semi-transparent side flaps (with sparse setae) on the sides of the scobinate bulla (Clench 1972), as seen in Fig. 8a View Fig , ventral view.

T

Tavera, Department of Geology and Geophysics

COI

University of Coimbra Botany Department

CMNH

The Cleveland Museum of Natural History

SMF

Forschungsinstitut und Natur-Museum Senckenberg

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Lepidoptera

Family

Riodinidae

Genus

Lasaia

GBIF Dataset (for parent article) Darwin Core Archive (for parent article) CoL Data Package (for parent article) View in SIBiLS Plain XML RDF