Emesis ( Tenedia ) tinia Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 20-22

publication ID

https://doi.org/10.5281/zenodo.16642576

DOI

https://doi.org/10.5281/zenodo.16802302

persistent identifier

https://treatment.plazi.org/id/4D7E87DA-4B6B-721E-FE42-F98CAD58FED3

treatment provided by

Felipe

scientific name

Emesis ( Tenedia ) tinia Grishin
status

new species

Emesis ( Tenedia) tinia Grishin , new species

http://zoobank.org/ D9E4D5FA-6B75-48AB-972E-9A232C625376

( Figs. 16 View Fig part, 17)

Definition and diagnosis. A specimen of Emesis [Fabricius], 1807 ( type species Hesperia ovidius Fabricius, 1793 , a junior subjective synonym of Papilio cereus Linnaeus, 1767 ) from Argentina belongs to a lineage originating in deep radiation of the subgenus Tenedia Grishin, 2019 ( type species Emesis tenedia C. Felder & R. Felder, 1861) thus being sister to several distant relatives, such as Emesis ocypore (Geyer, 1837) ( type locality given as “Africa”, likely in the Amazonian region) and Emesis angularis Hewitson, 1870 ( type locality in Ecuador) ( Fig. 16 View Fig ), and, therefore, it represents a new species. This species is not particularly similar to any other Emesis and might have been identified as Emesis diogenia Prittwitz, 1865 ( type locality in Brazil: Rio de Janeiro) due to locality and some similarity in wing shape, but it lacks two prominent submarginal spots (near the apex and tornus) of E. diogenia on the ventral hindwing. The new species differs from its relatives by smaller size, narrower wings, dull brown coloration with alternating darker brown and caramel brown bands and patches outlined by darker lines, dashes, and lunules; more uniformly colored on the ventral side with a pattern of rather evenly distributed spots and dashes and a more prominent discal darker band as the basal outline of the dark-brown streaks forming a broken wavy line. Due to unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne4719.2.2: T30 C, cne3798.9.9:G51A, cne 1556.1.19:C72 T, cne4207.2.2:C160 T, cne 1820.1.2: T180 C, cne3116.1.3:C69C (not T); and COI barcode: A40G, T83 C, A202C, C235 T, T283 C, T520 C, T547 C. Barcode sequence of the holotype. Sample NVG-24032C07, GenBank PV 549983, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGGGCAGGAATAGTGGGAACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCTATTATAATTGGAGGATTTGGTAATTGATTAGTCCCATTAATATTAGGAGCTCCAGACATAGCTTTTCCACGAA TAAATAATATAAGATTTTGATTATTACCCCCCTCATTAATCTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATCGC CCATGGTGGATCATCAGTGGATTTAGCCATTTTTTCTTTACATTTAGCTGGTATTTCTTCTATTTTAGGAGCAATTAATTTTATCACCACTATTATCAATATACGAATTAATAATTTATCA TTTGATCAAATACCTCTTTTTGTCTGATCTGTAGGCATTACAGCACTTTTACTTTTATTATCCTTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGTAATTTAAACACAT CATTTTTTGACCCTGCGGGAGGAGGTGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany ( MFNB), illustrated in Fig. 17 View Fig , bears the following five rectangular labels (1 st handwritten, others printed), four white: [ Argentinia | Rschus.], [Coll. | Staudinger], [DNA sample ID: | NVG-24032C07 | c/o Nick V. Grishin ], [{QR Code} MfN URI | http://coll.mfn- | berlin.de/u/ | 09c87b], and one red [HOLOTYPE ♂ | Emesis (Tenedia) | tinia Grishin].

Type locality. Argentina.

Etymology. The name is given for the country with the type locality: [Argen] tin { i} a, and also hints at a small size of this species. The name is treated as a noun in apposition.

Distribution. Currently known only from the holotype collected in Argentina.

T

Tavera, Department of Geology and Geophysics

MFNB

Museo Friulano di Storia Naturale

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Lepidoptera

Family

Riodinidae

Genus

Emesis

GBIF Dataset (for parent article) Darwin Core Archive (for parent article) CoL Data Package (for parent article) View in SIBiLS Plain XML RDF