Entheus proxemus Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 48-49

publication ID

https://doi.org/10.5281/zenodo.16642576

DOI

https://doi.org/10.5281/zenodo.16806840

persistent identifier

https://treatment.plazi.org/id/4D7E87DA-4B4F-7239-FE61-FCBAAC75FCE1

treatment provided by

Felipe

scientific name

Entheus proxemus Grishin
status

new species

Entheus proxemus Grishin , new species

http://zoobank.org/ 4EE1D5A2-1A38-4181-92C5-41E59B1C5AB2 ( Figs. 31 View Fig part, 36e–g, 39, 50 part, 51i)

Definition and diagnosis. Genomic analysis of Entheus Hübner, [1819] ( type species Papilio peleus Linnaeus, 1763 , which is a junior subjective synonym of Papilio priassus Linnaeus, 1758 ) reveals that a male from Pará, Brazil, is sister to Entheus telemus Mabille, 1898 ( type locality in Brazil), but is genetically differentiated from it at the species level ( Figs. 31 View Fig , 50 View Fig ); e.g., their COI barcodes differ by 1.5% (10 bp, a difference large for Entheus ), thus representing a new species. This new species keys to “ Entheus priassus telemus ” (B.10.4(b)) in Evans (1952) but differs from its relatives by a combination of the following characters in males (female unknown): forewing bands are yellower (not intensely orange as in E. telemus ), especially the subapical band and the spot between the bands, and narrower, i.e., the distal and basal margins of the discal band are more straight, the distal margin is not engulfing half of the posterior margin of the spot between the bands; the subapical band is broadly connected with the discal band from the anterior end of the discal cell towards the costa; the hindwing is entirely dark brown on both sides. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 2487.1.3:G54A, aly 2487.1.3:T63C, aly127.63.3:T1122C, aly3319.1.10:A153G, aly1042. 29.12:A108C, aly 2954.6.6:T306T (not C), aly26.15.3:A48A (not T), aly363.10.3:A258A (not T), aly7917.5.6: T384T (not C), aly 1036.5.1:A807A (not T); and COI barcode: A28A, T127T, C367T, G506A, 526C, A562G.

Barcode sequence of the holotype. Sample NVG-23064B05, GenBank PV549995, 658 base pairs:

AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACTTCCTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACTGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGACATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGACTCTTACCCCCATCATTAACATTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCCCCTTTATCTGCTAATATTGC CCATCAAGGATCTTCTGTAGATTTAGCCATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTCTATTTATTTGAGCAGTAGGTATTACCGCATTACTTTTATTATTATCTTTACCTGTATTAGCGGGTGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCAGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Figs. 39 View Fig and 51i View Fig (genitalia Fig. 36e–g View Fig ), bears the following seven printed rectangular labels, six white: [ Belém, Pará | Brazil | January 11, 1961 | D.L.Lindsley], [ Entheus Hübner | priassus (Linnaeus) | telemus Mabille ], [ D.L. Lindsley colln. | MGCL Accession | # 2008-20], [DNA sample ID: | NVG-23064B05 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-24064A01 | c/o Nick V. Grishin ], [genitalia: | NVG241111-01 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Entheus | proxemus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection .

Type locality. Brazil: Pará , Belém.

Etymology. The name is constructed as an antonym of its sister species’ name, telemus . In Greek, τηλε- ( tele -) is a prefix that means distant or far away. In Latin, proximus means nearest or next, and the name formed from this word is given to this species, nearest to E. telemus , with the distribution next to it. The name is treated as a masculine noun in apposition.

Distribution. Currently known only from the holotype collected in the lower Amazonian region.

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Lepidoptera

Family

Hesperiidae

SubFamily

Eudaminae

Tribe

Entheini

Genus

Entheus

GBIF Dataset (for parent article) Darwin Core Archive (for parent article) CoL Data Package (for parent article) View in SIBiLS Plain XML RDF