Entheus pano Grishin, 2025
|
publication ID |
https://doi.org/10.5281/zenodo.16642576 |
|
DOI |
https://doi.org/10.5281/zenodo.16804154 |
|
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4B47-7232-FD87-F979AD90FF11 |
|
treatment provided by |
Felipe |
|
scientific name |
Entheus pano Grishin |
| status |
new species |
Entheus pano Grishin , new species
http://zoobank.org/ 3A566915-7C92-470F-816F-5063C76BC6A0 ( Figs. 36l–o View Fig , 44 View Fig part, 46, 50 part, 51n)
Definition and diagnosis. Genomic analysis of Entheus Hübner, [1819] ( type species Papilio peleus Linnaeus, 1763 , which is a junior subjective synonym of Papilio priassus Linnaeus, 1758 ) reveals that a specimen from Panama is genetically differentiated from all other described taxa in the Entheus matho group at the species level, and its phylogenetic position differs in the trees constructed from different genomic regions (autosomes, Z chromosome, mitochondrial genome), indicating complexities in the evolution of this lineage ( Figs. 44 View Fig , 50 View Fig ). Its COI barcode differs by 2.1% (14 bp) from Entheus marmato Salazar & Vargas, [2017], stat. nov. ( type locality in Colombia: Caldas, Marmato-vereda Echandía), which is its sister in the mitochondrial genome tree ( Figs. 44c View Fig , 50c View Fig ). Therefore, this specimen represents a new species. This new species keys (incompletely) to “ Entheus matho matho ” (B.10.5(a)) in Evans (1952) and differs from its relatives by a combination of the following characters in males (female unknown): the forewing discal band is orange, semi-hyaline along parts of the distal margin, the apical band and the spot between the bands are semi-hyaline, orange-yellow, the spot is closer to the apical band than to the discal band, nearly rectangular, the two posterior spots of the apical band are offset by about their half-width distad from the rest at both margins of the band, the ground color is rusty brown, no basal reddish arc on the forewing, the anal fold is cream-white in the middle, slightly yellower towards its margins, and the hindtibial tuft is buff-tawny. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly54.45.5:C105 T, aly54.45.5:C108T, aly54.45.5:C123A, aly994.10.10: G75A, aly1651.42.9:C204T, aly1260.25.9:A134A (not G), aly240.18.17: T36 T (not C), aly240.18.17:G51G (not A), aly 1968.11.2:G69G (not A), aly 1968.11.2: T75 T (not G); and COI barcode: C19 T, A214 G, C364 T, C400 T, T478 C, T526 C.
Barcode sequence of the holotype. Sample NVG-14062B12, GenBank PV550000, 658 base pairs: AACTTTATATTTTATTTTTGGAATCTGAGCAGGAATAGTAGGTACTTCCCTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGTTTTGGAAATTGATTAGTACCTTTAATATTGGGAGCCCCTGATATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGACTTCTACCCCCATCATTAACATTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACAGTTTACCCCCCTTTATCTGCTAATATTGC TCATCAAGGATCTTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGCTGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAACTTATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACCGCACTACTTTTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTCTTTATCAACATTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Figs. 46 View Fig and 51n View Fig (genitalia Fig. 36l–o View Fig ), bears the following five printed rectangular labels, four white: [ PANAMA: Darien | Cana 1200m | 13.IX.1982 | Leg. G. B. Small], [DNA sample ID: | NVG-14062B12 | c/o Nick V. Grishin], [DNA sample ID: | NVG-23119E02 | c/o Nick V. Grishin], [genitalia: | NVG240817-41 | c/o Nick V. Grishin] , and one red [ HOLOTYPE ♂ | Entheus | pano Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection.
Type locality. Panama: Darién Province, Cana , elevation 1200 m.
Etymology. The name is formed from the name of the country with the type locality to end in - o as E. mato. The name is treated as a masculine noun in apposition.
Distribution. Currently known only from the holotype collected in eastern Panama.
| T |
Tavera, Department of Geology and Geophysics |
| USNM |
Smithsonian Institution, National Museum of Natural History |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
SubFamily |
Eudaminae |
|
Tribe |
Entheini |
|
Genus |
