Telegonus (Rhabdoides) tatus Grishin, 2025
|
publication ID |
https://doi.org/10.5281/zenodo.16642576 |
|
DOI |
https://doi.org/10.5281/zenodo.16806323 |
|
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4B0D-727B-FE3D-FCE4AD9CFB8B |
|
treatment provided by |
Felipe |
|
scientific name |
Telegonus (Rhabdoides) tatus Grishin |
| status |
new species |
Telegonus (Rhabdoides) tatus Grishin , new species
http://zoobank.org/ 2E3436DE-28EB-400F-9794-3865EF77ADFE ( Figs. 61 View Fig part, 85h–i, 86, 89 part)
Definition and diagnosis. A specimen from Panama (in USNM collection) that we initially identified by wing pattern as Telegonus crana (Evans, 1952) , stat. rest. ( type locality in Guatemala: San Gerónimo) is not in the same clade with it and instead is sister to Telegonus cretatus Hayward, 1939 ( type locality in Ecuador: Napo), but is genetically differentiated from it at the species level ( Fig. 61 View Fig ); e.g., their COI barcodes differ by 5.3% (35 bp), and, therefore, represents a new species. This new species keys (incompletely) to “ Astraptes alfius alfius ” C.14.27(a) in Evans (1952), which is a junior subjective synonym of T. cretatus , and shares unique for the genus male genitalia with a shorter and distally truncate (not pointed or rounded) harpe, but differs from it by males with even shorter and more rectangular harpe (more trapezoidal to square in T. cretatus ), more robust ampulla ( Fig. 85h View Fig ); darker base of the ventral hindwing that does not strongly stand out as a paler area, bluer (rather than greener) bases of wings above, and darker ground color of the wings beneath, thus with less prominent darker bands. It differs from similar in appearance T. crana by the presence of a greenish-blue streak along the ventral forewing costa at the base (the base is pale-brown without blue in T. crana ) and broader dark bands on the ventral side of wings. It differs from other relatives by a generally darker aspect reflected in the lack of a white spot in the middle of the dorsal forewing and stronger overscaled with brown area towards the costa on the ventral forewing, where the costal pale ray is separated from the central white band; and darker ventral hindwing, more weakly overscaled with yellow and broader dark bands. Due to unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 1350.11.2:T175A, aly 1350.11.2:A184G, aly 1350.11.2:G222C, aly114.21.1:T90A, aly84.18.5:G2604A, aly6654.6.4:T384T (not C), aly671.41.1:T192T (not C), aly876.8.1: G624G (not A), aly876.8.1:A1695A (not T), aly1838.36.4:A279A (not C); and COI barcode: G389A, T400C, T406C.
Barcode sequence of the holotype. Sample NVG-14111D05, GenBank PV550030, 658 base pairs: AACTTTATACTTTATTTTCGGAATTTGAGCAGGATTAATTGGAACTTCCTTAAGTTTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGTGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCCCTAATAATGGGAGCCCCTGATATAGCTTTTCCACGTA TAAATAATATAAGATTTTGACTTTTACCTCCATCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC TCATCAAGGAGCATCAGTTGACTTAACAATTTTTTCCTTACACTTAGCTGGTATTTCTTCCATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACAGCATTATTATTATTACTTTCATTACCAGTTTTAGCAGGAGCTATCACTATACTATTAACTGATCGAAACTTAAATACCT CATTTTTTGATCCAGCAGGAGGAGGTGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 86 View Fig (genitalia Fig. 85h, i View Fig ), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ PANAMA:PANAMA | 5 mi N El Llano | 330m 9 o 17'N 79 o 00'W | 14 Jun 1978 | leg. G.B.Small], [DNA sample ID: | NVG-14111D05 | c/o Nick V. Grishin], [DNA sample ID: | NVG-23119F03 | c/o Nick V. Grishin], [genitalia: | NVG240817-54 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | tatus Grishin] GoogleMaps . The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection.
Type locality. Panama: Panamá Province, 5 mi north of El Llano, elevation 330 m, approx. GPS 9.283, −79.000.
Etymology. The name is formed from its sister species’ name, cretatus , made shorter for this more northern relative, and is treated as a noun in apposition.
Distribution. Currently known only from the holotype collected in central Panama.
| USNM |
Smithsonian Institution, National Museum of Natural History |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
SubFamily |
Eudaminae |
|
Tribe |
Eudamini |
|
Genus |
