Nealyda grandipinella Bennett and Hayden, 2024

Hayden, Sidney V. Bennett James E., 2024, Review of Nealyda Dietz (Lepidoptera: Gelechiidae: Apatetrinae) with description of a new species from the Florida Keys, Insecta Mundi 2024 (86), pp. 1-13 : 3-8

publication ID

https://doi.org/10.5281/zenodo.14662477

publication LSID

lsid:zoobank.org:pub:3A1AD0AF-0026-470A-8D9B-1C70B9CF3B37

DOI

https://doi.org/10.5281/zenodo.17633006

persistent identifier

https://treatment.plazi.org/id/480287B8-FF85-FF96-FF70-937CFBEFF8B4

treatment provided by

Felipe

scientific name

Nealyda grandipinella Bennett and Hayden
status

sp. nov.

Nealyda grandipinella Bennett and Hayden , new species

( Fig. 1A View Figure 1 , 2A View Figure 2 , 3A View Figure 3 , 4A View Figure 4 , 5 View Figure 5 )

Diagnosis. Nealyda grandipinella differs from its congeners by the presence of silvery-gray scales throughout the forewing and a lack of brown pigmentation. The habitus is nearly indistinguishable from N. pisoniae specimens collected in the Bahamas, but it lacks the thick, dark gray band on the outer side of the first labial palpomere that is present in N. pisoniae . In the male genitalia, the most obvious difference is the arrangement of setae on the sacculus: they are thick and parallel in a comb-like row, twelve to fourteen in number, whereas the most similar species have a few thin setae ( N. kinzelella , N. pisoniae ) or numerous rough, irregularly disposed setae ( N. bifidella ). Nealyda grandipinella also differs by the conical shape of the uncus that terminates in circular scales, a straight, broad phallus with four terminal teeth, and valvae that are medially constricted, with the distal half broad, laterally curved, and lemon shaped. In related species, the uncus is truncate, the phallus is narrow and curved without teeth, and the terminal expansion of the valva is narrower and not distinctly bent laterad. In the female genitalia, the ductus bursae is 33% longer than the corpus bursae, and the signum is curved, hook-shaped, and 1/5 as long as the corpus bursae. Congeners have the ductus bursae and corpus bursae subequal in length. In most other species, the central spine of the signum is 1/7 or less the length of the corpus bursae. Nealyda bifidella has a spine 1/3 the length of the corpus bursae and distinct lateral granular arms of the signum, but the ductus bursae has a distinct membranous swelling halfway along its length.

Description, Adult. Head ( Fig. 2A View Figure 2 ). Labial palps slightly rounded and stout. Outer side light gray, with dark gray banding at apex, base of third segment, and distal end of second segment. Inner side with suffusion of white scales proximal to the frons and dark gray scales on opposite side. Vertex with broad, rounded scales that widen towards apex, smaller and more linear anteriad; scales dark gray subapically, only reaching the margin in more linear scales, pale gray on margin. Antennal scape light gray with black band at apex. Basal third of antenna with alternating gray and dark gray flagellomeres, becoming completely gray in distal two-thirds. Eyes light gray. Variation in intensity of irroration, nearly absent in some specimens. Silver or whitish ocelli.

Thorax. Dorsal surface of thorax with broad light gray scales with thin white band at apex.

Wings ( Fig. 1A View Figure 1 ). Basal half of forewing with gray scales with rounded white apex. Antemedial fascia wide, black, followed by thin white fascia. Medial area with gray and white scales similar to those of basal half of wing. Postmedial fascia diffuse black, with lateral pointed projection of black scales near costa. Elongate, lateral patch of black scales near inner margin. White irroration near apex, diffusing into linear, dark gray scales with white apex. Terminal fringe dark gray. Hindwings with medial cleft extended less than a third of the wing’s length. Light gray, infuscated at apex.

Pregenital abdomen. Scales similar to those on thorax. Tuft of yellow-white setae extending beyond final tergite to cover genital opening and valvae.

Legs. Coxa and femur of prothoracic legs with scales light gray with dark gray suffusion on anterior surface. Scales on posterior side yellow white. Tibia light gray with three dark-gray bands on distal side; epiphysis present. First tarsomere long, light gray with two black bands on distal side. Other tarsomeres dark gray at base and becoming light gray at apex. Mesothoracic legs with coxa cream colored, pattern otherwise similar to front legs except banding indistinct. Two lateral spurs arising one slightly above the other near distal end of tibia. Metathoracic legs with coxa and femur yellow grayish white with large, diffuse, light-gray spots. Tibia light gray near base, distally dark gray with four lateral spurs. Medial pair with inner spur more than 2 times the length of outer spur, extended to distal end of tibia in both sexes, becoming slightly broader at apex. Second pair of spurs subequal in length, slightly shorter than shorter medial spur, at distal end of tibia. First tarsomere dark gray with two yellow-white bands, one at base and one at apex; other tarsomeres dark gray.

Male genitalia ( Fig. 3A View Figure 3 ). Valvae slightly bulbous at base, with many microtrichia, becoming constricted medially and expanding to lemon shape with slight upturned point at corona. Cucullus with microtrichia, most dense at corona. Sacculus bluntly rounded, about half the length of valvae, with strongly sclerotized apex and small blunted projection. Apex of sacculus with thick, comb-like setae. Vinculum band shaped, terminating shortly before tegumen. Uncus broadly conical, with many long microtrichia. Four large, circular scales at apex about 0.25x size of uncus, extending to about the same length as the valvae. Tegumen trapezoidal with few microtrichia, extending slightly longer than length of uncus. Gnathos thin, semicircular. Phallus ~ 0.25 mm, ankylosed, spinose.

Female genitalia ( Fig. 4A View Figure 4 ). Corpus bursae broadly ovular. Signum a slightly curved hook, about 0.25x length of corpus bursae. Ductus bursae relatively narrow and straight, ~ 1 mm, lacking any sclerotization. Ductus seminalis arising from posterior portion of ductus bursae. Ostium bursae funnel shaped. Papillae anales large, elliptical, heavily sclerotized, ~ 0.33 mm, with many long microtrichia, some extending the length of papillae anales.

Immature stages. Unknown.

DNA barcode. The DNA COI barcode sequence is as follows (diagnostic sites in bold italics): CTTTATATTTTATTTTTGGTATTTGAGCAGGTATAGTTGGAACTTCT C TAAG C TTATTAATTCGAGCTGAATTAGGAA C TCCTGG T TCTTTAAT TGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGG G TTTGGA AATTGATTAGTACCTTTAATATT G GGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCTTCTTTAACTT TA C TAATTTCTAGAAGTAT C GTAGAAAATGGAGCAGG T ACAGGATGAACAGTTTACCCCCCTCTTTCTTCTAATATTGCTCATGGAGG T ACTTC AGT T GATTTAGCAATTTT C TCTCTTCATTTAGCAGGTATTTCATCAATTTTAGGAGCTAT C AATTTTATTACAACTATTATTAATATAAAAATT AATGG CC TATCTTTTGATCAAATACCACTTTTTGTTTGAGCAGTAGGTAT C ACAGCTTTACTT C T T CTTTTATCTTTACCTGTATTAGCAGGAGC AATTACAATACTTTTAACAGATCGTAATTTAAATACATCATTTTTTGA

The most closely related available COI sequence is GONA176-10, sample ID SL0379, an undetermined Nealyda specimen collected in Puerto Rico, deposited in the MEM.

Host. Unknown. Predicted to be Guapira or Pisonia ( Nyctaginaceae ).

Distribution ( Fig. 5 View Figure 5 ). Big Pine Key, Monroe County, Florida, USA.

Type specimens. Holotype: 1 ♂ “ USA, FL, Mon. Co. Big Pine Key, Key Deer Blvd. Trailhead . 24.7096, -81.3826, UVL [trap], 12-13-IV-2018, P. Corogin, B. Danner, J. Farnum, J. Hayden, J. Stanley, E, Talamas, L. Whilby. E18- 1830; J.E. Hayden photo index 424, FLMNH-MGCL Slide 07061; FLMNH-MGCL Specimen 164645 ”. Deposited in the FSCA. GoogleMaps

Paratypes (9): USA, Florida: 4 ♂ “USA, FL, Mon. Co. Big Pine Key, Key Deer Blvd. Trailhead. 24.7096, -81.3826, UVL [trap], 12-13-IV-2018, P.Corogin, B. Danner, J. Farnum, J.Hayden, J.Stanley, E.Talamas, L. Whilby. E18-1830” GoogleMaps ; one “FLMNH-MGCL Slide 04702 | FLMNH-MGCL Specimen 164644 ; one “DNA JEH-2019-0122B | FLMNH-MGCL Specimen 164646 ; others FLMNH-MGCL Specimens 164647 , 164648 . 1 ♂ “ USA, FL, Mon. Co. Big Pine Key, Palmetto Ave . 24.6726, -81.3634 CAPS malaise 26-XII-2018 –8-I-’19 J. Farnum E19-94 | FLMNH-MGCL Specimen 164649 GoogleMaps ; 1 ♀ same locality label as previous, “MGCL Slide 05021 | FLMNH-MGCL Specimen 164653 GoogleMaps ; 1 ♂ “ USA, FL, Mon. Co. Big Pine Key, Palmetto Ave. 24.67261, -81.36339 M.T. 16–28-V-2019 CAPS, J. Farnum E19-3054 | FLMNH-MGCL Specimen 164650 GoogleMaps ; 1 ♀ “ USA, FL, Mon. Co. Big Pine Key, Palmetto Ave. 24.67261, -81.36339 CAPS malaise trap 23-VII–7-VIII-2019 J. Farnum E19-4439 | FLMNH-MGCL Specimen 164651 GoogleMaps ; 1 ♂ “ USA, FL, Mon Co. Big Pine Key, Key Deer Refuge, Manillo Trail 24.70969, -81.38266 CAPS malaise trap, 27-I–11-II-2020 J. Farnum E20-547 | FLMNH-MGCL Specimen 164652 ”. Deposited in the FSCA GoogleMaps .

Etymology. The species is named for Big Pine Key, Monroe County, Florida. It is a feminine Latin adjective.

Additional material examined. Nealyda bifidella : 1 ♂ “ TEXAS: Cottle Co. Matador WMA 17-V-85 leg. E. Knudson | MGCL Ascension #2016-40 E.C. Knudson, Knudson/Bordelon | FLMNH-MGCL Slide 05097”; 1 ♀ “TX: Jeff Davis Co. TNC-Davis Mts. Pr. Bridge Gap 7300, 11-V-00/B/K | FLMNH-MGCL Slide 05098”; 1 ♂ “ 13 May 1996 black light trap leg J.S. Nordin COLORADO: Mesa Co. T13 S R99 W Sect. 5, 3.4 m. SW of Whitewater via Hwy 141, East Creek, El. 4780 ft | MGCL Accession #2018-3 J. Nordin | FLMNH-MGCL Slide ♂ 07066 | FLMNH-MGCL Specimen 164622”.

Nealyda kinzelella : 1 ♂, 2 ♀ “ USA, FL, Monroe Co. Cudjoe Key, Rte   GoogleMaps 1 & Cutthroat Dr. 24.66385, -81.47875. UVL 12-13-IV-2018 J. Hayden, P. Corogin, B. Danner, J. Farnum, E. Talamas, J. Stanley, L. Whilby. E18-1829”, of which ♂ “FLMNH-MGCL Slide 04703”, first ♀ “ FLMNH-MGCL Slide 04984”, second ♀ “ J.E. Hayden photo index 419”; 1 ♂ “ USA, FL, Monroe Co. Sugarloaf Key, 24.67338, -81.5130 Ex mine Guapira obtusata 22-III-2018 J. Farnum E18-1873 | FLMNH-MGCL Slide 04696”.

Nealyda phytolaccae : 1 ♂, 2 ♀ “ USA, FL, M.- Dade Co. Miami, 601 NW 7 th St. Rd.   GoogleMaps 25.779384, -80.207936 CAPS survey, ex Guapira discolor 5-I-2018 P. Perez E18-59;” of which ♂ “ Ecl. 10-I-2018; FLMNH-MGCL Slide 04551;” first ♀ “ Ecl. 8-I-2018; FLMNH-MGCL Slide 04549;” second ♀ “Ecl. 8-I-2018; J.E. Hayden photo index 420”. 1 ♀ “ USA, FL, Mon Co. Key Largo 99540 Overseas Hwy. In   GoogleMaps Guapira discolor leaves 25.094424, -80.442358. 23-I-2018 O. Garcia E18-233. Ecl. 25-I-2018; FLMNH-MGCL Slide 04985;” 1 ♀ “ USA, FL, Monroe Co. Islamorada, Lignumvitae Key St. Pk.   GoogleMaps 24.90231, -80.8949 ex Guapira discolor 31-X-2018 J.M. Farnum E18-6146; FLMNH-MGCL Slide 04983;” 1 ♀ “ FLORIDA: Monroe Co. 1 mi SW. Islamorada, Upper Matecumbe Key 23-VI-1974; AT (UV) BLACKLIGHT; J.B. Heppner collector; FLMNH-MGCL Slide 05059;” 2 ♂ “ USA, FL, Miami-Dade Co. Key Biscayne, Bill Baggs St.   GoogleMaps Pk. 25.67746, -80.16155 reared ex Guapira discolor lvs 31-I-2019 J. Farnum, L. Golden E19-547”, one “FLMNH-MGCL Slide 05099”, one “FLMNH-MGCL Slide 07065; FLMNH-MGCL Specimen 164621”.

Nealyda pisoniae : 1 ♀ “ FL: Monroe Co. Upper Matecumbe Key, Islamorada 31-VII-1992 W. Lee Adair, Jr. | W.L. Adair Collection – 2003 | J.E. Hayden photo index 423”; 1 ♀ “ FL: Monroe Co. Upper Matecumbe Key, Islamorada 5-IX-1992 W. Lee Adair, Jr. | W.L. Adair Collection – 2003 | FLMNH-MGCL Slide 05058”; 1 ♂ “ FL: Monroe Co. Upper Matecumbe Key, Islamorada 5-IX-1992 W. Lee Adair, Jr. | W.L. Adair Collection – 2003 | FLMNH-MGCL Slide 04113”; 1 ♂ “ BAHAMAS: Great Inagua 0.95 mi. SE of lighthouse 20.92694, -73.661111, 26.vii.2014 M.J. Simon & G. Goss | Bahamas Survey MGCL Accession No. 2014-21 | FLMNH-MGCL Slide 05056 | MGCL 238208 ”; 1 ♀ same locality and accession data as above, one “MGCL-FLMNH Slide 05057 | MGCL 238211 ”, one “ MGCL 238209 ”.

Nealyda sp. : 5 leafmines “E14-3392, USA, FL, M-Dade Co. Key Biscayne, Bill Baggs Cape St. Pk. Crandon Blvd. Guapira discolor . 14-V-2014 L. Whilby, M. DaCosta et al. CAPS-IMS”.

Nealyda sp. : 1 ♀ “ Bexar Co. Texas, San Antonio, Leg. E.C. Knudson, 29-VII-84 | MGCL Ascension #2016- 40, E.C. Knudson, Knudson/Bordelon | FLMNH-MGCL slide 07018”; 1 ♀ “TX: Val Verde Co. 15 mi. W. Del Rio, 19-VIII-95 leg/ E. Knudson | MGCL Accession #2016-40, E.C. Knudson, Knudson/Bordelon”.

Nealyda sp. : 1 ♂ “ PERU: Dept. Junin, Pampa Hermosa Lodge nr. San Ramon , 1220 m, 6-7 Nov 2009 J. Heppner | FLMNH-MGCL slide 07048 | FLMNH-MGCL Specimen 164606”; 1 ♂ “ PERU: Dept. of Junin, Pampa Hermosa Lodge Nr. San Ramon, 1220 m, 2-6 Apr 2011 J.B. Heppner & C. Carrera ”.

FSCA

Florida State Collection of Arthropods, The Museum of Entomology

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Lepidoptera

Family

Gelechiidae

SubFamily

Apatetrinae

Genus

Nealyda

GBIF Dataset (for parent article) Darwin Core Archive (for parent article) CoL Data Package (for parent article) View in SIBiLS Plain XML RDF