Ernassa justina Stoll, [1782]
publication ID |
https://doi.org/ 10.11646/zootaxa.5493.4.1 |
publication LSID |
lsid:zoobank.org:pub:9CEA6F9D-A998-4967-8E00-AC2BE9A0AE13 |
DOI |
https://doi.org/10.5281/zenodo.13687524 |
persistent identifier |
https://treatment.plazi.org/id/2C176A0B-FFCA-9C4E-3EA8-ABAE560714A6 |
treatment provided by |
Plazi |
scientific name |
Ernassa justina Stoll, [1782] |
status |
|
Ernassa justina Stoll, [1782] View in CoL
( Figs. 1–6 View FIGURES 1–2 View FIGURES 3–6 )
Neotype: Travassos, 1944:2–5.
Diagnosis: Oblique reddish spot that goes from the middle of the posterior margin to the angle at M 3 -Cu 1, bears a visible thin black line. The lower part of the outer margin, slightly lobed. Base of valva narrow, dorsal process long, narrow and curved. It is the only species that has valvae of this shape.
Material examined. FRENCH GUYANA. 1 male, Haute Mana, St. Leon , 24–30.ix.2003, O. Morgan leg. (GENITALIA # JGA-1234 , MUSM) . PERÚ. LORETO. 1 male, Río Arabela, Campamento Piraña 7B, 01°54’06”, 75°22’56”, 221 m, 16.ii.2008,W. Paredes ; 1 male, Z. R. Allpahuayo-Mishana , 03°56’S, 73°28’W, 130 m, 11.viii.2004, J.J. Ramírez GoogleMaps ; 1 male, Picuroyacu , 03°39’S, 73°15’W, 110 m, 28.vi.2014, J.J. Ramírez GoogleMaps ; 1 male, Z. R. Allpahuayo-Mishana , 03°56’S, 73°28’W, 130 m, 11.viii.2004, J.J. Ramírez (GENITALIA # JGA-1242 , MUSM) GoogleMaps ; 1 male, Melitón Carbajal , 04°14’S, 73°34’W, 153 m, 15.vii.2012, J.J. Ramírez GoogleMaps ; 1 male, idem except (GENITALIA # JGA-1247 , MUSM) GoogleMaps ; 1 male, idem except (GENITALIA # JGA-1243 , MUSM) GoogleMaps ; 1 male, San Regis, Albergue La Posada , 04°30’30”S, 73°54’30”W, 130 m, 07.vii.2002, J.J. Ramírez (GENITALIA# JGA-1246 , MUSM) GoogleMaps . MADRE DE DIOS. 1 male, Posada Amaz. , 12°48’17”S, 69°17’35”W, 280 m, 30.ix.2004, T. Mc Cabe GoogleMaps ; 1 male, Tambopata Preserve, Laguna chica, 12°51’S, 69°18’W, 200 m, 07.xii.1996, Miller / Snyder / Brower / Rab-Green GoogleMaps ; 1 male, Albergue Refugio Amazonas, 12°52’30”S, 69°24’35”W, 231 m, 10.ii.2016, J. Grados ( MUSM, ARCT-342 , JGA COLLECTION)(Voucher DNA barcoding, Arct #005 JGA-MUSM) GoogleMaps ; 1 male, idem except, 14.iii.2016, D. Couceiro ( MUSM, ARCT-366 JGA COLLECTION)(Voucher DNA barcoding, Arct #29 JGA-MUSM) GoogleMaps ; 1 male, idem except, 02.x.2016 ( MUSM, ARCT-447 , JGA COLLECTION)(Voucher DNA barcoding, Arct #110 JGA-MUSM) GoogleMaps ; 1 male, Albergue Refugio Amazonas, 12°52’30”S, 69°24’35”W, 231 m, 07.x.2016, D. Couceiro leg. GoogleMaps ; 1 male, idem except, 10.x.2016 ( MUSM, ARCT-481 JGA COLLECTION)(Voucher DNA barcoding, Arct # 144 JGA-MUSM)(GENITALIA # JGA-1295 , MUSM) GoogleMaps ; 1 male, idem except, 02.i.2017 ( MUSM, ARCT-571 JGA COLLECTION)(Voucher DNA barcoding, Arct #234 JGA-MUSM) GoogleMaps ; 1 male, idem except, 18.vi.2017 ( MUSM, ARCT-650 JGA COLLECTION)(Voucher DNA barcoding, Arct #313 JGA-MUSM) GoogleMaps ; 1 male, 12.vii.2017 ( MUSM, ARCT-689 JGA COLLECTION)(Voucher DNA barcoding, Arct #352 JGA-MUSM) ; 1 male, idem except, 02.viii.2017 ( MUSM, ARCT-735 JGA COLLECTION)(Voucher DNA barcoding, Arct #398 JGA-MUSM) ; 1 male, idem except, 05.viii.2017 ( MUSM, ARCT-738 JGA COLLECTION)(Voucher DNA barcoding, Arct #401 JGA-MUSM)(GENITALIA # JGA-1296 , MUSM) ; 1 male, idem except, 13.viii.2017 ( MUSM, ARCT-759 JGA COLLECTION)(Voucher DNA barcoding, Arct #422 JGA-MUSM) ; 1 male, idem except, 12.ix.2017 ( MUSM, ARCT-842 JGA COLLECTION)(Voucher DNA barcoding, Arct #505 JGA-MUSM) ; 1 male, idem except, 14.ix.2017 ( MUSM, ARCT-848 JGA COLLECTION)(Voucher DNA barcoding, Arct #511 JGA-MUSM) ; 1 male, idem except, 16.ix.2017 ( MUSM ARCT-854 JGA COLLECTION)(Voucher DNA barcoding, Arct #517 JGA-MUSM) ; 1 male, idem except, 18.ix.2017 ( MUSM, ARCT-865 JGA COLLECTION)(Voucher DNA barcoding, Arct #528 JGA-MUSM) ; 1 male, idem except, 25.ix.2017 ( MUSM, ARCT-910 JGA COLLECTION)(Voucher DNA barcoding, Arct #573 JGA-MUSM) ; 1 male, idem except, 27.ix.2017 ( MUSM, ARCT-914 JGA COLLECTION)(Voucher DNA barcoding, Arct #577 JGA-MUSM) ; 1 male,idem except, 27.ix.2017 ( MUSM, ARCT-916 JGA COLLECTION)(Voucher DNA barcoding, Arct #579 JGA-MUSM) ; 1 male, idem except, 15.x.2017 ( MUSM, ARCT-934 JGA COLLECTION)(Voucher DNA barcoding, Arct #597 JGA-MUSM) ; 1 male, idem except, 07.x.2017 ( MUSM ARCT-924 JGA COLLECTION)(Voucher DNA barcoding, Arct #587 JGA-MUSM) ; 1 male, idem except, 17.x.2017 ( MUSM, ARCT-939 JGA COLLECTION)(Voucher DNA barcoding, Arct # 602 JGA-MUSM) ; 1 male, idem except, 09.xii.2017 ( MUSM, ARCT-990 JGA COLLECTION)(Voucher DNA barcoding, Arct #653 JGA-MUSM) ; 1 male, idem except, 16.xii.2017 ( MUSM, ARCT-995 JGA COLLECTION)(Voucher DNA barcoding, Arct # 658 JGA-MUSM) ; 1 male, Albergue Refugios Amazonas, 12°52’30”S, 69°24’35” 231 m, 15.iii.2018, J.D. Shoobridge et al. ( MUSM, ARCT-1050 JGA COLLECTION)(Voucher DNA barcoding, Arct #713 JGA-MUSM) ; 1 male, idem except, 20.iii.2018 ( MUSM, ARCT-1061 JGA COLLECTION)(Voucher DNA barcoding, Arct #724 JGA-MUSM) ; 1 male, idem except, 21.iii.2018 ( MUSM, ARCT-1065 JGA COLLECTION)(Voucher DNA barcoding, Arct #728 JGA-MUSM) ; 1 male, idem except, 05.v.2018 ( MUSM, ARCT-1193 JGA COLLECTION)(Voucher DNA barcoding, Arct #856 JGA-MUSM) ; 1 male, idem except, 16.v.2018 ( MUSM, ARCT-1203 JGA COLLECTION)(Voucher DNA barcoding, Arct #866 JGA-MUSM) ; 1 male, idem except, 19.vi.2018 ( MUSM ARCT-1254 JGA COLLECTION)(Voucher DNA barcoding, Arct #917 JGA-MUSM) ; 1 male, idem except, 28.vi.2018 ( MUSM, ARCT-1273 JGA COLLECTION)(Voucher DNA barcoding, Arct #936 JGA-MUSM) ; 1 male, Albergue Refugios Amazonas, 12°52’30”S, 69°24’35”W, 231 m, 22.viii.2018, J.D. Shoobridge et al GoogleMaps .; 1 male, idem except, 18.ix.2018 GoogleMaps ; 1 male, idem except, 20.ix.2018 GoogleMaps ; 1 male, idem except, 26.xii.2018 GoogleMaps ; 1 male, idem except, 16.vi.2019 GoogleMaps ; 1 male, idem except, 05.vii.2019 GoogleMaps ; 1 male, P.N. Bahuaja-Sonene , 13°11’35”S, 70°07’56”W, 353 m, 05.vi.2013 J. Grados, E. Razuri & J. Barrientos. All deposited in the MUSM GoogleMaps .
Male ( Figs.1–2 View FIGURES 1–2 ). Description of the adult male and the genital organs is found in Travassos (1944). Male genitalia ( Figs. 3–6 View FIGURES 3–6 ) (Genitalia # JGA 1234, 1242, 1243, 1246, 1247, 1295, 1296). Tegumen with narrow sides, the anterior margin shaped as an inverted “U”. Uncus as wide as the distal part of tegumen; two rounded processes, somewhat sclerotized at the base, with abundant long and thick bristles on their posterior side; distally narrow, pointed and hook-shaped at its terminal part, a concave notch on its ventral part. Saccus short with sinusoid margin. Valva. Lateral view: wide at its base; ventral process membranous, wide, short and bearing setae, distal end rounded; dorsal process sclerotized, curved, longer than the base of the valva. Ventral view: wide at the base; mesal margins spreading distally; towards the inside, with a pronounced sinusoid invagination and abundant setae. Juxta obcordate and sclerotized. Transtilla triangular, with the base at the anterior margin; sclerotized on the sides.Aedeagus elongate and sinusoid; coecum penis elongate; vesica membranous and elongate, narrower towards the distal part, with minute spicules.
Female. Unknown.
Distribution: French Guiana, Brazil ( Travassos, 1944) and Peru (Loreto and Madre de Dios). Barcoding: The mitochondrial DNA sequence (COI) of one of the specimens from the Tambopata River is (Voucher MUSM-Arctiinae VBC #144) (GenBank: BankIt2839965 gnl|uoguelph|RFEWA144-17.COI-5P PP911850) (See Table 1 View TABLE 1 ) as follows:
AACATTATACTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCATTAAGTTTATTAATTC GAGCTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAG CACATGCTTTTATTATAATTTTTTTCATAGTTATACCAATTATAATTGGAGGTTTTGGAAACTGAC TAGTCCCTTTAATATTAGGAGCTCCAGATATAGCTTTCCCCCGAATAAATAACATAAGTTTTT GACTTCTACCCCCATCATTAACCTTATTAATTTCAAGAAGAATTGTTGAAAACGGAGCTGGAACAG GATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATGGTGGAAGTTCAGTAGACTTAGC TATCTTTTCTTTACATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATCACAACAATTAT TAATATACGATTAAATAATCTATCATTTGATCAAATACCTTTATTTGTATGAGCTGTAGGAATTACCG CATTTTTATTATTACTTTCATTACCTGTTTTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATTTA AATACTTCATTTTTTGATCCTGCAGGAGGAGGAGACCCAATTCTTTACCAACATTTATTT
Remarks. The species was described by Stoll ([1782]) from Suriname, without mentioning the number of specimens. The high probability of the type being lost, made Travassos (1944) designate a Neotype, through a specimen from Pará ( Brazil) (Neo-typus: Nº60.025), deposited in the MNRJ. With the disaster of September 2, 2018 at the National Museum of Rio de Janeiro, the neotype disappeared. However, the drawings published by Travassos (1944) on the morphology of the male genitalia have allowed the identification of the species.
R |
Departamento de Geologia, Universidad de Chile |
T |
Tavera, Department of Geology and Geophysics |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
SubFamily |
Arctiinae |
Genus |