Catharylla tenellus (Zeller, 1839)

Leger, Theo, Landry, Bernard, Nuss, Matthias & Mally, Richard, 2014, Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae), ZooKeys 375, pp. 15-73 : 35-38

Catharylla tenellus (Zeller, 1839) Figs 4, 17, 18, 27-29, 37, 45

Crambus tenellus Zeller, 1839: 174-175

Catharylla tenella : Zeller 1863: 50; Bleszynski and Collins 1962: 226; Landry 1993: 1088; Munroe 1995: 35; Nuss et al. 2013.

Argyria tenella : Zeller 1877: 58; Dyar 1914: 317

Platytes tenella : Hampson 1896: 944

Type material.

Holotype. ♀, “Type” [red ringed]; "Catharylla | tenella Z[eller]. | Mon[ograph]. p[age]. 50 Am. anftr." [not clearly readable]; "Zell[er]. Coll[ection]. | 1884"; "♀ | Pyralidae | Brit[ish]. Mus[eum]. | Slide N° | 1094". Deposited in BMNH.

Other specimens examined. 20 ♂, 7 ♀. BRAZIL: 3 ♂ (1 ♂ with leg used for DNA barcoding BC MTD 01842, 1 ♂ with genitalia on slide BL 1757), São Paulo, Ubatuba, Picinguaba, 23°22'S, 44°50'W, 2-20m, 22-24.ix.2001 (V. O. Becker n°132820) (Becker Coll.); 2 ♂ with same data except 10-12.xi.2001 (V. O. Becker n°133712) (Becker Coll.); 2 ♂, 1 ♀ (1 ♂ with genitalia on slide BL 1741, ♀ genitalia on slide BL 1742), São Paulo, Bertioga, 5 m, 5.xi.1995 (V. O. Becker n°99090) (USNM); 1 ♂ (genitalia on slide BL 1778) with same data (Becker Coll.); 1 ♂ (genitalia on slide BL 1775) with same data except 15-17.v.1996 (V. O. Becker n° 99386) (Becker Coll.); 1 ♂ with same data except 7-9.x.1996 (V. O. Becker Coll. n°99757) (Becker Coll.); 1 ♂ (used for DNA sequencing and barcoding LEP 975, BC MTD 01711, genitalia on slide TL 13), São Paulo, São Luiz do Paraitinga, 23°20'S, 45°06'W, 900 m, 13-20.iii.2001 (V. O. Becker n°132356) (Becker Coll.); 1 ♂ (genitalia on slide Pyralidae Brit. Mus. Slide N° 19065), São Paulo, 700 m (E. D. Jones) (BMNH); 1 ♂ (genitalia on slide BL 1746), Minas Gerais, Caraça, 1300 m, 1-2.iv.1992 (V. O. Becker n°85081) (USNM); 1 ♀ (genitalia on slide BL 1754) with same data (Becker Coll.); 1 ♂ (genitalia on slide BL 1755) with same data except 25.x.1994 (V. O. Becker & K. S. Sattler, n°93291) (Becker Coll.); 1 ♂, 1 ♀ (♂ used for DNA sequencing and barcoding LEP 973, BC MTD 01709, genitalia on slide TL 11, ♀ genitalia on slide BL 1758), Bahia, Porto Seguro, A. d’Ajuda, 16°27'S, 39°03'W, 20 m, 12.vii.2009 (V. O. Becker n°144140) (Becker Coll.); 2 ♂ (used for DNA sequencing and barcoding, one with labels LEP 972, BC MTD 01888, genitalia on slide TL 10, other with labels LEP 974, BC MTD 01710, genitalia on slide TL 12) with same data except 15.viii.2008 (V. O. Becker n°140808) (Becker Coll.); 1 ♂ (used for DNA sequencing and barcoding LEP 971, BC MTD 01708, genitalia on slide TL 9) with same data except 1-3.v.2009 (V. O. Becker n°142784) (Becker Coll.); 1 ♂, Paranà, Castro (USNM); 1 ♀ (genitalia on slide BL 1733), Rio de Janeiro, xi[day and year data missing] (H. H. Smith) (CMNH); 1 ♀ (genitalia on Pyralidae Brit. Mus. Slide N°19069), Rio de Janeiro, Corcovado, 457 m, 26.xii.1958 (E. P. Wiltshire) (BMNH). No locality data: 1 ♂, 1 ♀ (♂ genitalia on slide Nat[ur]. hist[orisches]. Mus[eum]. Wien Gen[italia]. Praep[aration]. MV 9022a, ♀ genitalia on slide Nat. hist. Mus. Wien Gen. Praep. MV 9022b); 1 ♀ (genitalia on slide Nat. hist. Mus. Wien Gen. Praep. MV 9022c), 1869 (NMW).

COI barcode sequence of specimen BC MTD 1710 (654 bp): ACTCTATATTTTATCTTTGGAATTTGATCAGGAATAATTGGAACATCTTTAAGATTATTAATTCGAGCAGAATTAGGGAATCCTGGATCTCTAATTGGAGATGATCAAATTTATAACACTATTGTAACAGCCCATGCATTTATTATAATTTTTTTTATGGTTATACCAATTATAATTGGTGGATTTGGAAATTGATTGGTTCCATTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAACATAAGATTTTGGTTATTACCCCCTTCCTTAACTCTTTTAATTTCTAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACGGTCTACCCCCCCCTTTCATCTAATATTGCCCATAGTGGAAGATCTGTAGATTTAGCAATCTTTTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGTAATTTATCTTTTGATCAAATACCTTTATTTGTTTGATCAGTCGGTATTACAGCTTTACTTCTTCTTCTATCTTTACCTGTATTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACATCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATCTTATATCAACATTTA

Diagnosis.

From Catharylla serrabonita and Catharylla coronata , Catharylla tenellus can be separated by the median transverse line, which is faintly convex towards costa, whereas it is more strongly convex in Catharylla coronata and Catharylla serrabonita . The male genitalia provide the best diagnostic characters. The most obvious refers to the transtilla, which forms a pair of short, narrow sclerotized arms with pointed tips, projecting posterad, with, in between, a pair of brushes directed medio-ventrally, whereas it forms a pair of arms pointing posterad with a string of spines ventrally in Catharylla serrabonita and Catharylla coronata . In female genitalia, the anterior angle of sternite VIII is directed downward into a more or less rounded projection covered with short spinules of same length, whereas it is projected anterad in Catharylla serrabonita , and it is not projected in Catharylla coronata .

Redescription.

Male (n = 20) (Fig. 4): Head white with ochreous chaetosemata. Antenna brown with ochreous scales. Maxillary palpi ochreous to brown, white tipped. Labial palpi: 1.1-1.4 mm long; basally white, medially brown ochreous with white tips. Thorax slightly ochreous at collar. Foreleg coxa white; femur ochreous, dorsally dark brown; tibia and tarsomeres ochreous, distally ringed with dark brown. Midleg light ochreous with tibia-femur joint brown; tarsomeres II–V dark brown on upperside, with white ringed tips. Hindleg white; tarsomeres as midleg. Forewing length: 10.5-12 mm; snow white; costal line ochreous, lightly pronounced from base to apex; median and subterminal transverse lines ochreous, median transverse line faintly convex towards costa; outer margin ochreous with 7 dark brown spots often triangular, strongly pronounced; fringes brass colored; underside ochreous with costal margin pronounced in basal half and marginal spots pronounced. Hindwing cream-coloured; outer margin with small ochreous brown spots forming more or less continuous line between Sc+R1, Rs, M1, M2, M3, CuA1 and CuA2; underside light ochreous, with marginal spots pronounced; fringes white.

Tympanal organs (n = 13): Transverse ridge more or less regularly rounded, medially more straight. Tympanic pocket extending slightly beyond transverse ridge. Tympanic drum ovoid, posteriorly not extended beyond transverse ridge. Tympanic bridge faintly sclerotized.

Male genitalia (n = 13) (Figs 17, 18, 27-29): Uncus about half of length of tegumen arms, broadly downcurved; uncus arms connecting at base, with ventro-lateral tuft of setae; dorsal furrow with few short setae on each side, tip rounded, slightly indented medially, slightly convex in apical 1/3. Gnathos short and thick, arms joining at half of length, laterally compressed toward apex, almost straight, slightly downcurved, with apex pointing upward. Tegumen arms slightly enlarging toward apex; connecting at 3/4, slightly projected dorsally at connection. Costa of valva at 2/3 with arm directed postero-dorsally with rounded tip, without basal projection on dorsal edge or narrow with low basal projection, or wide with basal projection; cucculus upcurved in apical 1/4. Juxta ogival, posteriorly directed downward, with pair of thumb-like lobes ventrally reaching about 2/3 of length. Transtilla strongly sclerotized, with pair of narrow arms on each side of middle, pointing posterad, with 3 spines apically, also with pair of shorter brushes of tightly set spines medio-ventrally; in some specimens triangular median projection dorsally with few tiny setae. Phallus S-shaped, subapically with dorsal bump, apically lightly sclerotized, truncated, covered with microspicules barely visible; vesica without cornuti.

Female (n = 7): Labial palpi: 1.6-2 mm; forewing length 12-16 mm; frenulum triple.

Female genitalia (n = 7) (Fig. 37): Papillae anales straight, thick. Posterior apophyses narrow 0.3-0.45 × length of papillae anales, slightly wider basally. Intersegmental membrane between segments VIII and IX covered with microspines. Tergite VIII laterally about 2X longer than dorsally; sternite VIII formed by 2 lobes regularly narrowing downward in more or less triangular shape, not connected ventrally, densely covered with short spinules of same length; ventro-anterior angle of sternite VIII slightly projected downward, rounded, covered with short spinules; anterior margin of segment VIII latero-dorsally strongly sclerotized, thicker; posterior margin with dorsal line of setae. Anterior apophyses 0.02-0.05 × length of papillae anales. Sterigma membranous, covered with spinules. Ductus bursae about 3 × length of corpus bursae, narrow. Corpus bursae elongate, sometimes with one signum.

Distribution.

The species is known from Brazil in the Atlantic Forest (Bahia, Minas Gerais, Paraná, Rio de Janeiro, Saõ Paulo) (Fig. 45).

Notes. The species was described from "one female collected in Brazil, near Rio de Janeiro". Hence, the lectotype designated by a label by S. Bleszynski is not warranted. This designation is presumably based on the fact that Zeller (1863: 50) mentions a pair deposited in the Vienna Museum. The association of sexes in this species is not 100% certain.

Specimens from Porto Seguro, Brazil show a divergence of 3.34% in COI barcode sequences with the specimen from Ubatuba, Brazil. In morphology, differences in male genitalia are also observed: in the specimens from Bertioga, Caraça, São Paulo and Ubatuba the costal arm of the valva is wide and 1/3 of the length of the cucullus, almost reaching its tip, and the dorsal edge at base is slightly produced (Fig. 27). In the specimens from Porto Seguro, the costal arm is about 1/5 the length of the cucullus, relatively narrow, and the dorsal edge is slightly produced at base (Fig. 29). Another form, from Caraça, Minas Gerais (Fig. 28) was also found. No differences were found in the female genitalia. We feel that specimens and data are currently lacking to conclude that possibly more than one taxon should be recognized under Catharylla tenellus , or that there is indeed a deep divergence in the COI barcode between populations of this species.