Bowie borneo S. Li & Yao, 2022

Chu, Chang, Lu, Ying, Li, Shuqiang & Yao, Zhiyuan, 2022, Taxonomic notes on eleven species of the subfamily Cteninae (Araneae, Ctenidae) from Asia, Biodiversity Data Journal 10, pp. 96003-96003 : 96003

Bowie borneo S. Li & Yao sp. n.

Materials

Type status: Holotype. Occurrence: recordedBy: Z. Chen; individualCount: 1; sex: male; lifeStage: adult; Taxon: order: Araneae; family: Ctenidae ; genus: Bowie ; Location : country: Malaysia; stateProvince: Borneo ; verbatimLocality: State of Sabah, Mount Trus Madi , Jungle Girl Camp ; verbatimElevation: 1234 m a.s.l.; verbatimLatitude: 5°33.000'N; verbatimLongitude: 116°30.960'E; Event: samplingProtocol: Collected by hand in leaf litter; year: 2016; month: 4; day: 27; Record Level: institutionCode: IZCAS-Ar 43730

Description

Male (IZCAS-Ar 43730): PL 3.8, PW 2.9, AW 1.2, OL 3.2, OW 2.2. Eye diameters and interdistances: AME 0.17, ALE 0.15, PME 0.22, PLE 0.21, AME-AME 0.14, AME-ALE 0.11, PME-PME 0.24, PME-PLE 0.27, AME-PME 0.11, ALE-PLE 0.13, clypeus AME 0.09, clypeus ALE 0.37. Palp and leg measurements: palp 5.1 (2.5, 0.5, 0.8, -, 1.3), I 12.1 (2.8, 1.5, 3.2, 3.3, 1.3), II 10.9 (3.2, 1.3, 2.6, 2.7, 1.1), III 9.6 (2.7, 1.1, 2.1, 2.6, 1.1), IV 15.1 (4.0, 1.4, 3.3, 4.7, 1.7). Leg formula 4123. Spination of palp and legs: palp 151, 100, 1110; femora I p012, d111, r012, II-III p112, d111, r112, IV p112, d111, r002; patellae I-II 100, III-IV 101; tibiae I p010, r010, v212222, II p100, d001, r110, v22222, III-IV p11, d111, r11, v222; metatarsi I p111, r011, v222, II p111, d002, r111, v222, III p111, d012, r111, v222, IV p111, d012, r111, v2212. Chelicerae with 3 promarginal, 4 retromarginal teeth and with elongated patch of 8 tiny denticles along entire cheliceral furrow. Retromargin of chelicerae close to fang base with 4 bristles. Sparse scopula on all tarsi. Leg claws I-II with 5 and III-IV with 4 secondary teeth. Position of tarsal organ: I 1.07, II 0.89, III 0.72, IV 1.06.

Palp (Fig. 22 a-c). RTA protruding at an almost right angle from tibia in ventral view, with slightly hooked tip. Cymbium tip slightly conical and with weakly developed dorso-proximal outgrowth. Embolus (Fig. 28 d) arising at 7 o’clock position. Conductor arising at 11 o’clock position. Tegular apophysis arising from tegulum sub-proximally, with narrow base and wide tip.

Colour (Fig. 23 a and b). Yellowish-brown with darker patterns. Dorsal prosoma with characteristic lighter median band, widened behind eyes, eye field with sparse white hairs, with distinctly marked fovea and distinct radial markings. Sternum, labium, gnathocoxae and ventral coxae yellowish-brown without patterns. Chelicerae reddish-brown with longitudinal patterns. Palps and legs yellowish-brown, legs II-IV with distinct patterns. Dorsal opisthosoma yellowish with black patches, anterior margin and central region light. Lateral opisthosoma spotted. Ventral opisthosoma yellowish-brown with posteriorly converging lines of spots. Anterior lateral spinnerets laterally dark, posterior lateral and median spinnerets and anal tubercle light.

Female

Unknown.

Diagnosis

Small Ctenidae (total length male 7.0). The new species is assigned to the chinagirl -species group with the characteristics of compact embolus, thick-walled, with rounded edges and with an entire margin, the tegular apophysis is longitudinally elongated, not covering the embolus. It resembles B. abdulmajid Jäger, 2022 (see Jäger 2022: figs 638-643 and 696-699) by having similar dorso-proximal cymbial outgrowth, embolus and RTA (Fig. 22 a-c and Fig. 28 d), but can be distinguished by the base of tegular apophysis having no bulge (Fig. 22 b; the base of tegular apophysis bulging beyond tegulum margin in B. abdulmajid ), by the tibia having no distinct broad longitudinal ridge ventrally (Fig. 22 b; tibia with distinct broad longitudinal ridge ventrally in B. abdulmajid ) and by the conductor nearly quadrilateral (Fig. 22 b; conductor nearly oval in B. abdulmajid ).

Etymology

The specific name refers to the type locality and is a noun in apposition.

Distribution

Malaysia (Borneo, type locality; Fig. 1 ).

DNA Barcode

Male (IZCAS-Ar 43730):

GGTTTGGTGCTTGGGCTTCTATAGCAGGTACGTCTATAAGAGTTTTGATTCGAATGGAATTAGGACATTCTGGAAGATTATTAGGGGATGATCATTTATATAATGTTGTTGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTGATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTGGTTCCTTTAATATTAGGAGCTCCTGATATATCTTTTCCTCGTATAAATAATTTGTCGTTTTGATTACTTCCTCCTTCTTTATTTTTATTGTTTATATCTTCTATGACTGAGATAGGGGTGGGAGCTGGTTGGACGGTTTATCCACCTTTGGCTTCTGGAATTGGTCATGCAGGAAGATCGATAGATTTTGCTATCTTTTCTCTCCATTTAGCAGGTGCTTCTTCTATTATAGGAGCTATTAATTTTATTTCTACGATTATTAATATACGATTATTAGGAATGAGAATGGAAAAGGTTCCTTTGTTTGTATGGTCTGTTTTTATTACTGCAGTTTTATTATTATTATCTTTACCTGTTTTAGCGGGTGCTATTACTATATTATTAACGGATCGTAATTTTAATACTTCTTTTTTCGATCCTGCTGGAGGAGGGGATCCAATTTTATTTCAACATTTATTTTGATTTTTTG (GenBank accession number OP572103).

Figures

Figure 1. Distribution records of ctenid spiders from Asia in this study. 1. Amauropelma krabi sp. n.; 2. Am. phangnga sp. n.; 3. Am. saraburi sp. n.; 4. Anahita medog sp. n.; 5. An. popa; 6. Bowie fascination; 7. B. ninhbinh sp. n.; 8. B. vinhphuc sp. n.; 9. B. borneo sp. n.; 10. B. engkilili sp. n.; 11. B. sabah sp. n.

Figure 22. Bowie borneo sp. n., palp, holotype. a: Prolateral view; b: Ventral view; c: Retrolateral view. C = conductor, DPO = dorso-proximal outgrowth of cymbium, E = embolus, RTA = retrolateral tibial apophysis, TA = tegular apophysis. Scale bar: 0.2 mm (a-c).

Figure 23. Bowie borneo sp. n., habitus, holotype male. a: Dorsal view; b: Ventral view. Scale bar: 1.0 mm (a, b).