Bowie sabah S. Li & Yao, 2022

Chu, Chang, Lu, Ying, Li, Shuqiang & Yao, Zhiyuan, 2022, Taxonomic notes on eleven species of the subfamily Cteninae (Araneae, Ctenidae) from Asia, Biodiversity Data Journal 10, pp. 96003-96003 : 96003

Bowie sabah S. Li & Yao sp. n.

Materials

Type status: Holotype. Occurrence: recordedBy: Z. Chen; individualCount: 1; sex: male; lifeStage: adult; Taxon: order: Araneae; family: Ctenidae ; genus: Bowie ; Location : country: Malaysia; stateProvince: Borneo ; verbatimLocality: State of Sabah, Mount Trus Madi , Jungle Girl Camp ; verbatimElevation: 1234 m a.s.l.; verbatimLatitude: 5°33.000'N; verbatimLongitude: 116°30.960'E; Event: samplingProtocol: Collected by hand in leaf litter; year: 2016; month: 5; day: 3; Record Level: institutionCode: IZCAS-Ar 43732 Type status: Paratype. Occurrence: recordedBy: Z. Chen; individualCount: 1; sex: female; lifeStage: adult; Taxon: order: Araneae; family: Ctenidae ; genus: Bowie ; Location : country: Malaysia; stateProvince: Borneo ; verbatimLocality: State of Sabah, Mount Trus Madi , Jungle Girl Camp ; verbatimElevation: 1234 m a.s.l.; verbatimLatitude: 5°33.000'N; verbatimLongitude: 116°30.960'E; Event: samplingProtocol: Collected by hand in leaf litter; year: 2016; month: 5; day: 3; Record Level: institutionCode: IZCAS-Ar 43733

Description

Male (IZCAS-Ar 43732): PL 6.4, PW 5.1, AW 2.3, OL 4.8, OW 3.6. Eye diameters and interdistances: AME 0.22, ALE 0.17, PME 0.27, PLE 0.23, AME-AME 0.25, AME-ALE 0.40, PME-PME 0.34, PME-PLE 0.49, AME-PME 0.17, ALE-PLE 0.29, clypeus AME 0.11, clypeus ALE 0.52. Palp and leg measurements: palp 8.2 (3.0, 1.2, 1.6, -, 2.4), I 20.5 (5.6, 2.6, 5.4, 5.1, 1.8), II 17.4 (5.1, 2.5, 4.3, 4.2, 1.3), III 14.5 (4.3, 2.2, 3.2, 3.7, 1.1), IV 22.4 (6.1, 2.2, 5.4, 6.8, 1.9). Leg formula 4123. Spination of palp and legs: palp 161, 001, 111; femora I p021, d111, r1111, II p112, d111, r112, III p001, d222, r112, IV p012, d111, r112; patellae I-IV 101; tibiae I p110, d111, r11, v22222, II p110, d11, r11, v22222, III-IV p11, d111, r11, v222; metatarsi I-II p111, d012, r111, v222, III p111, d002, r111, v222, IV p111, d012, r111, v222. Chelicerae with 3 promarginal, 4 retromarginal teeth and with elongated patch of 23 tiny denticles along entire cheliceral furrow. Retromargin of chelicerae close to fang base with 6 bristles. Sparse scopula on all tarsi and metatarsi I-III. Leg claws I with 5, II with 4, III with 5 and IV with 6 secondary teeth. Position of tarsal organ: I with 1.64, II 1.15, III 0.96, IV 1.28.

Palp (Fig. 26 a-c). RTA arising from tibia subdistally, with slightly hooked tip. Cymbium tip slightly conical and with weakly-developed dorso-proximal outgrowth. Embolus (Fig. 28 e) arising at 8 o’clock position, with membranous extension at its base and with spermophor opening situated subapically. Conductor arising at 10 o’clock position. Tegular apophysis arising at 6 o’clock position, its base situated on a slightly proximally protruding part of tegulum.

Colour (Fig. 27 c and d). Yellowish-brown with darker patterns. Dorsal prosoma with characteristic lighter median band, widened behind eyes, eye field with sparse white hairs, with distinctly marked fovea and radial markings. Sternum and ventral coxae III + IV yellowish-brown with patches, coxae I + II yellowish-brown without patterns, labium and gnathocoxae yellowish-brown with lighter distal lips. Chelicerae dark yellowish-brown with longitudinal patterns. Palps and legs yellowish-brown, legs III + IV with distinct patterns. Dorsal opisthosoma yellowish-brown with black patches, anterior margin and central region light. Lateral opisthosoma spotted. Ventral opisthosoma dark brown with posteriorly converging lines of spots. Anterior lateral spinnerets laterally dark, posterior lateral and median spinnerets and anal tubercle light.

Female (IZCAS-Ar 43733): PL 5.9, PW 4.4, AW 3.0, OL 5.2, OW 3.5. Eye diameters and interdistances: AME 0.23, ALE 0.19, PME 0.27, PLE 0.25, AME-AME 0.20, AME-ALE 0.44, PME-PME 0.33, PME-PLE 0.52, AME-PME 0.17, ALE-PLE 0.28, clypeus AME 0.13, clypeus ALE 0.51. Palp and leg measurements: palp 5.8 (2.1, 1.1, 1.2, -, 1.4), I 13.9 (4.0, 2.1, 3.6, 3.1, 1.1), II 12.8 (3.8, 2.1, 3.0, 2.9, 1.0), III 11.3 (3.5, 1.7, 2.4, 2.7, 1.0), IV 16.7 (4.6, 1.9, 3.8, 4.9, 1.5). Leg formula 4123. Spination of palp and legs: palp 131, 001, 112, 203; femora I p021, d111, r011, II p012, d111, r111, III p112, d111, r112, IV p002, d111, r112; patellae I-II 000, III-IV 101; tibiae I-II v22222, III-IV p11, d111, r11, v222; metatarsi I-II v222, III-IV p111, d012, r111, v222. Chelicerae with 3 promarginal, 4 retromarginal teeth and with elongated patch of 12 tiny denticles along entire cheliceral furrow. Retromargin of chelicerae close to fang base with 7 bristles. Sparse scopula restricted almost entirely to tarsi, only metatarsi I-II with sparse scopula hairs. Palpal claw with 5 secondary teeth, leg claws I with 2, II with 3, III with 4 and IV with 3 secondary teeth. Position of tarsal organ: I 0.97, II 0.84, III 0.75, IV 1.06.

Copulatory organ (Fig. 27 a and b). Epigynal field roughly as long as wide; constrictive anterior width/widest width: 0.53/1.15. Lateral teeth originating at posterior margin of median plate. Internal duct system with two large vulval folds laterally. Spermathecae bottle gourd-shaped. Vulval folds separated by less than the spermathecae length and subparallel medially. Fertilisation ducts pointing antero-medially.

Colour (Fig. 27 e and f). As in male, except for being darker, reddish-brown. Chelicerae dark reddish-brown without pattern.

Diagnosis

Medium-sized Ctenidae (total length male 11.2, female 11.1). The new species is assigned to the scarymonsters -species group with the characteristics of embolus with a basal, ventral bulge (best seen in prolateral view), tegulum bulging proximally at tegular apophysis base, the subdistally arising, apically pointed RTA in males, transversally oval median plate and lateral teeth situated at posterior margin of epigyne and spermathecae bottle gourd-shaped. It resembles B. neukoeln Jäger, 2022 (see Jäger 2022: figs 440-446 and 448-460) by having similar dorso-proximal cymbial outgrowth, RTA (Fig. 26 a-c) and lateral teeth (Fig. 27 a), but can be distinguished by the embolus tip visible in ventral view (Fig. 26 b and Fig. 28 e; tegular apophysis covering the embolus tip in ventral view in B. neukoeln ), by the tegular apophysis longitudinally orientated (Fig. 26 b; tegular apophysis diagonally orientated in B. neukoeln ), by the conductor nearly quadrilateral (Fig. 26 b; conductor nearly elliptic in B. neukoeln ) and by the constrictive anterior width/widest width: 1/2 (Fig. 27 a; constrictive anterior width/widest width: 1/3 in B. neukoeln ).

Etymology

The specific name refers to the type locality and is a noun in apposition.

Distribution

Malaysia (Borneo, type locality; Fig. 1 ).

DNA Barcode

Male (IZCAS-Ar 43732):

GGTTTGGAGCTTGAGCTTCTATAGTAGGAACATCTATAAGAGTATTAATTCGTATAGAATTAGGACATTCTGGAAGATTATTAGGAGATGATCATTTATATAATGTAGTTGTTACTGCTCATGCTTTTGTTATGATTTTTTTTATAGTAATGCCTATTTTAATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGGGCTCCTGATATATCTTTTCCTCGAATAAATAATTTATCATTTTGATTACTTCCTCCTTCTTTATTCTTATTATTTATGTCTTCTATAACTGAGATAGGAGTAGGAGCTGGTTGAACAGTATATCCTCCCTTAGCTTCTAGAATAGGACATATGGGAAGATCAATGGATTTTGCTATTTTTTCTCTTCATTTAGCTGGGGCTTCCTCTATTATAGGAGCTATTAATTTTATTTCTACAATTATTAATATACGATTATTGGGAATAAGAATAGAGAAAGTTCCATTATTTGTGTGGTCTGTTTTTATTACTGCGGTATTGTTGTTATTGTCTTTACCTGTTTTAGCAGGTGCTATTACTATATTATTAACGGATCGTAATTTTAATACTTCTTTTTTTGACCCAGCTGGGGGGGGGGATCCCATTTTATTTCAACATTTATTTTGATTTTTGC (GenBank accession number OP572111).

Female (IZCAS-Ar 43733):

GGTTTGGAGCTTGAGCTTCTATAGTAGGAACATCTATAAGAGTATTAATTCGTATAGAATTAGGACATTCTGGAAGATTATTAGGAGATGATCATTTATATAATGTAGTTGTTACTGCTCATGCTTTTGTTATGATTTTTTTTATAGTAATGCCTATTTTAATTGGAGGTTTTGGAAATTGATTAGTTCCTCTAATATTAGGGGCTCCTGATATATCTTTTCCTCGAATAAATAATTTATCATTTTGATTACTTCCTCCTTCTTTATTCTTATTATTTATGTCTTCTATAACTGAGATAGGAGTAGGAGCTGGTTGAACAGTATATCCTCCCTTAGCTTCTAGAATAGGACATATGGGAAGATCAATGGATTTTGCTATTTTTTCTCTTCATTTAGCTGGGGCTTCCTCTATTATAGGAGCTATTAATTTTATTTCTACAATTATTAATATACGATTATTGGGAATAAGAATAGAGAAAGTTCCATTATTTGTGTGGTCTGTTTTTATTACTGCGGTATTGTTGTTATTGTCTTTACCTGTTTTAGCAGGTGCTATTACTATATTATTAACGGATCGTAATTTTAATACTTCTTTTTTTGACCCAGCTGGGGGGGGGGATCCCATTTTATTTCAACATTTATTTTGATTTTTGC (GenBank accession number OP572109).

Note

B. sabah sp. n. belongs to the scarymonsters -species group because of the abovementioned characteristics, so the "diagonally orientated TA" in the diagnosis of the scarymonsters -species group in Jäger (2022) should be changed to "tegulum bulging proximally at TA base".

Figures

Figure 1. Distribution records of ctenid spiders from Asia in this study. 1. Amauropelma krabi sp. n.; 2. Am. phangnga sp. n.; 3. Am. saraburi sp. n.; 4. Anahita medog sp. n.; 5. An. popa; 6. Bowie fascination; 7. B. ninhbinh sp. n.; 8. B. vinhphuc sp. n.; 9. B. borneo sp. n.; 10. B. engkilili sp. n.; 11. B. sabah sp. n.

Figure 26. Bowie sabah sp. n., palp, holotype. a: Prolateral view; b: Ventral view; c: Retrolateral view. C = conductor, DPO = dorso-proximal outgrowth of cymbium, E = embolus, RTA = retrolateral tibial apophysis, TA = tegular apophysis. Scale bar: 0.5 mm (a-c).

Figure 27. Bowie sabah sp. n. a: Paratype female, epigyne, ventral view; b: Same, vulva, dorsal view; c: Holotype male, habitus, dorsal view; d: Same, habitus, ventral view; e: Paratype female, habitus, dorsal view; f: Same, habitus, ventral view. FD = fertilisation duct, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 2.0 mm (c-f).