Pseudojuloides zeus, Benjamin C. Victor, 2015
publication ID |
https://doi.org/ 10.5281/zenodo.18327 |
DOI |
https://doi.org/10.5281/zenodo.6110347 |
persistent identifier |
https://treatment.plazi.org/id/03FE8786-3932-FF8A-5A20-F57551DE7F41 |
treatment provided by |
Donat |
scientific name |
Pseudojuloides zeus |
status |
n. sp. |
Pseudojuloides zeus , n. sp.
Zeus Pencil Wrasse
Figures 1–3, Table 1.
Holotype. BPBM 41215, 60 mm SL, male, Majuro, Marshall Islands , Micronesia, aquarium-trade collectors, Sep. 15, 2013 .
Paratype. BPBM 37701 , 67.5 mm SL, male, Blue Holes, Ngemelis Island, Palau , Micronesia, 7.137° N, 134.221° E, 79–88m, J.L. Earle, May 11, 1997 GoogleMaps .
Diagnosis. Dorsal-fin rays IX,11; anal-fin rays III,12; pectoral-fin rays 13–14 (13); lateral-line scales 27 (+1 on tail), 1.5 scales above anterior lateral line to dorsal-fin base; no scales on head; gill rakers 14; a single pair of large, forward projecting canine teeth anteriorly in each jaw, the lowers fitting between uppers when mouth closed; few irregular short pointed but flattened teeth on each side of upper and lower jaws, no canine posteriorly at corner of mouth; very elongate body, body depth 5.65–5.75 in SL; only slightly compressed, body width 1.4–1.55 in depth; caudal fin slightly rounded; terminal-phase male in life with yellow-green head and body, two prominent jagged-edged iridescent blue stripes along sides of body, a yellow spinous dorsal fin, a large black spot at base of mid-dorsal fin, and a mostly black caudal fin.
Description. Dorsal-fin rays IX,11; anal-fin rays III,12; all soft dorsal and anal segmented rays branched, last split to base; pectoral-fin rays 13–14 (13), the first rudimentary, the second unbranched; pelvic rays I,5; principal caudal rays 14, the upper and lower unbranched, one additional segmented ray and 3-4 visible unsegmented procurrent rays upper and lower; pored lateral-line scales 27 (+1 on caudal-fin base); gill rakers 14 (14).
Body very elongate, the depth 5.65 (5.75) in SL, and only slightly compressed, the width 1.55 (1.4) in depth; head length 3.15 (3.15) in SL; dorsal profile of head nearly straight on snout, forming low angle of about 20° to horizontal axis of body, and slightly convex on nape; snout sharply pointed, its length 3.6 (3.5) in head length; orbit diameter 4.7 (4.85) in head length; interorbital space broadly convex, the least bony width 4.55 (5.1) in head length; caudal peduncle short and narrow, the least depth 3.5 (3.6) in head length, caudal-peduncle length 3.15 (2.8) in head length.
Mouth very small, terminal, the corner of gape with closed jaws well anterior to anterior nostril; end of maxilla buried, even when jaws open. Lips moderate. A pair of large, forward projecting canine teeth anteriorly in each jaw, the lower pair fitting between uppers when mouth closed (canines of holotype broken); paratype with two smaller canines behind lower canines, very few teeth present along bony ridges behind canines, one or two on each quadrant, flattened but pointed; no canine tooth posteriorly on upper jaw. Upper preopercular margin free nearly to level of lower edge of orbit; lower margin free anterior to a vertical through anterior nostril. Gill rakers short, the longest on first arch (at angle) about one-fifth to one-tenth length of longest gill filament. Nostrils small, in front of upper edge of orbit, the anterior in a short membranous tube elevated posteriorly, the posterior in advance of a vertical through front of orbit by a distance slightly less than internarial space. Pores on lower half of head comprise one over rear maxilla, then two anterior to orbit, followed by a curving suborbital series (counting up to rear mid-eye level) numbering 6–7 in single series; preopercular pores in a curved series after start of free edge near mandible, numbering 9 or 10 along free margin of preopercle, plus 1 or 2 more up to rear mid-eye level, in a single series at distal tips of canals.
Scales thin and cycloid; scales on side of thorax less than half as high as largest scales on side of body, becoming still smaller ventroanteriorly; head naked except for small partially embedded scales on nape in irregular rows; median predorsal scales extending forward to slightly posterior to a vertical through upper free end of preopercular margin; fins naked except for several progressively smaller scales on basal region of caudal fin and mid-ventral scale projecting posteriorly from base of pelvic fins. Lateral line continuous with 27 pored scales, nearly following contour of back to 19th pored scale, below base of eighth or ninth dorsal-fin soft ray, where deflected sharply ventrally to straight peduncular portion, single small pore per scale, first portion with short dorsal branch to pore, last pored scale on caudal-fin base (except for no pore on first scale of tail on one side of paratype). One and a half scales between scales of first portion of lateral line and dorsal-fin base.
Origin of dorsal fin above second lateral-line scale; dorsal spines progressively longer, the first 4.7 (5.35) and the ninth 3.25 (3.25) in head; longest dorsal soft ray 3.05 (2.7) in head; origin of anal fin below base of last dorsal spine; first anal-fin spine short, 10.65 (9.3) in head; second anal-fin spine 6.2 (5.95) in head; third anal-fin spine 4.45 (4.65) in head; longest anal soft ray 3.2 (2.9) in head; caudal fin slightly rounded, caudal-fin length 1.85 (1.8) in head; third pectoral-fin ray longest, 1.8 (1.8) in head; pelvic fins short, 2.4 (2.35) in head.
Color in life. Terminal phase male with yellow-green head grading to greenish on rear body. Two broad jagged-edged iridescent blue stripes along the sides of the body, usually two scales wide: the upper stripe wider and starting behind the operculum, the lower with a thin extension onto the cheek and only one scale wide from the pectoral-fin base to midbody. Both stripes widening rearward to mostly cover the narrow caudal peduncle. Spinous dorsal fin bright yellow, soft dorsal fin with yellow band distally; a black, mostly oval spot on the lower half of the fin over the first few dorsal-fin soft rays. Proximal two-thirds of caudal fin prominently black with upper and lower margins with an iridescent blue band. Pelvic and anal fins mostly yellowish to transparent. Iris bright yellow to orange-red. Initial phase females and juveniles are unknown, but based on P. mesostigma and the genus in general, they are reddish orange with a white ventral aspect and yellowish fins (in some live photographs, P. mesostigma females can have whitish bars as well).
Color in alcohol. Color is yellowish brown except for dark markings on fins in formalin-preserved paratype. The ethanol-preserved holotype retains the white ventrum and dark markings, as well as some indication of the iridescent blue stripes.
Etymology. Since the jagged blue stripes of this species resemble lightning bolts, this species is named for the Greek god Zeus, who liked to cast bolts of lightning at unsuspecting mortals, such as the physician Asclepius who became a little too presumptuous. The specific epithet is a noun in apposition.
Distribution and habitat. The new species appears limited to Micronesia, thus far being collected only in Palau and Majuro. The first specimen (paratype) was collected by the 1997 ‘Twilight Zone’ Expedition of the Bishop Museum by John Earle diving with Richard Pyle at 80 to 90m depth in the famed Blue Holes dive site in Palau. Subsequently, several individuals have been collected for the aquarium trade from similar depths in Majuro (and primarily shipped to Japan). However, the particularly deep habitat is very poorly sampled and surveyed and the species may well have a wider range. Curiously, another deep-water wrasse, Cirrhilabrus earlei Randall & Pyle 2001 , was also discovered on the same dive in Palau as P. zeus , and is also collected for the aquarium trade by the same commercial collectors in Majuro.
Barcode DNA sequence. A 652-nucleotide sequence of the segment of the mitochondrial COI gene used for barcoding by the BOLD informatics database (Ratnasingham & Hebert 2007) was obtained for the holotype. Following the database management recommendation of the BOLD, the sequence of the holotype (GenBank accession number KJ 591656) is presented here as well:
CCTTTATCTAGTATTCGGTGCCTGAGCTGGGATGGTGGGCACAGCCCTAAGCCTGCTCATCCGGGC TGAGCTTAGCCAGCCCGGCGCTCTCCTCGGAGACGACCAAATTTATAACGTAATCCCACGCCTTCG TAATAATCTTCTTTATAGTAATACCAATTATAATCGGCGGGTTCGGAAACTGATTAATTCCCTTAATGA TTGGGGCCCCCGACATGGCCTTCCCTCGAATAAATAACATAAGCTTCTGGCTTCTTCCTCCGTCTTT CCTTCTTCTCCTCGCCTCGTCAGGCGTAGAAGCAGGGGCTGGCACTGGGTGAACAGTTTACCCTCC CCTAGCTGGTAATCTTGCCCACGCAGGGGCCTCTGTAGACCTCACTATCTTCTCCCTTCACTTGGCA GGTATTTCTTCAATCCTGGGAGCAATCAACTTTATTACTACCATTATTAACATGAAACCCCCTGCTAT TTC TCAGTACCAAACACCTCTCTTTGTATGAGCCGTTTTAATTACAGCAGTCCTCCTCCTTCTCTCG CTGCCCGTTCTTGCTGCCGGCATCACAATGCTTCTAACTGATCGTAACCTCAACACCACCTTCTTTG ACCCTGCTGGCGGAGGTGACCCCATTCTTTATCAACATCTC Comparisons. Among the Pseudojuloides , P. zeus most closely resembles P. mesostigma in marking patterns and the very slender shape. The body depth is less than 18% SL for the two species (Table 1) vs. 18% to 20% for P. mesostigma and P. erythrops in Randall & Randall (1981) and 19% to 23% for P. severnsi and P. edwardi in Victor & Randall (2014). Other species, including the P. cerasinus complex, have a body depth well over 20% SL (Randall & Randall 1981, Connell et al. 2015). In addition, P. zeus and P. mesostigma share broad iridescent blue markings on the side, a dark area on the mid-dorsal fin, a yellowish spinous dorsal fin, and a mostly black caudal fin; however, in P. mesostigma the blue markings are reticulated and not organized into stripes and the black area on the dorsal fin is a large patch extending to the distal fin edge and also extends in a broad patch onto the upper body ( Figs. 4 & 5; Nishiyama & Motomura 2012). The two species are apparently allopatric, with P. mesostigma reportedly ranging from Japan through the Philippines and Indonesia to New Guinea and the northern GBR in Australia (Kuiter 2010), as well as Tonga (Randall et al. 2003) and Vanuatu (aquarium trade), but not New Caledonia (Fricke et al. 2011). P. zeus is apparently limited to Micronesia, well beyond the continental influence of the Coral Triangle. The habitat of the two species is deep rubble slope areas on reefs, although P. mesostigma is found shallower than P. zeus , usually cited as 25 to 45m (Allen & Erdmann 2012).
DNA Comparisons. The neighbor-joining phenetic tree based on the COI mtDNA sequences of 11 of the 13 known Pseudojuloides species, following the Kimura two-parameter model ( K 2 P) generated by BOLD (Barcode of Life Database), shows deep divergences between species and relatively small differences within species, except for the P. edwardi and P. severnsi sequences, which are very close ( Fig. 6). As a broad generality, among most reef fishes the minimum interspecific distance between close congeners is often up to an order of magnitude greater than the maximum intraspecific distance, which is precisely what makes the barcode database particularly useful. It appears that the majority of reef fish species (with many exceptions) differ by more than 2% from their P-distances (uncorrected pairwise) for mtDNA COI sequences of 11 species of Pseudojuloides
nearest relatives (Steinke et al. 2009, Ward et al. 2009, Victor 2015). Our genetic results agree with the close relationship between P. zeus and P. mesostigma based on appearance; the two species share a branch on the neighbor-joining tree and differ by 5.31% in COI sequence ( K 2 P; 5.07% uncorrected pairwise). This degree of divergence is similar to that of some other sibling-species pairs in the genus, where, for all but one pair, minimum interspecific distances range from 3.5% to 20.38% ( K 2 P distances, vs. 3.4% to 17.51% uncorrected pairwise). The maximum intraspecific distances range from 0 to 0.93% (0 to 0.92% uncorrected pairwise), showing a clear “barcode gap” between species (Table 2). The exception is the species pair of P. edwardi and P. severnsi , which diverge by only 0.46% (three nucleotides of the 652-bp barcode segment), and may be an example of phenotypic differences outpacing the rate of neutral substitutions in the mitochondrial COI DNA sequence early in the process of speciation (Victor & Randall 2014, Allan et al. 2015).
Other material of Pseudojuloides examined. P. mesostigma - Vanuatu (aquarium trade), BPBM 41216 , 2: 60.6– 60.9 mm, Mar. 15, 2014 .
BPBM |
USA, Hawaii, Honolulu, Bernice P. Bishop Museum |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |