Evius ocassus, Grados, 2018

Grados, Juan, 2018, Four new species and one new subspecies of Arctiinae (Lepidoptera: Erebidae) from the Tambopata river, Madre de Dios, Peru, Zootaxa 4434 (1), pp. 29-48 : 35-37

Evius ocassus sp. nov.

( Figs. 17–24 )

Holotype male ( Figs. 17–18 ): PERU, Madre de Dios, Albergue Refugio Amazonas , 12°52'30''S, 69°24'35''W, 231m, 21.iv.2016 (D. Couceiro). 73 Paratypes (42 males and 31 females): PERU, Madre de Dios , 1 male, CICRA, Río Los Amigos , 12°34'07.35''S, 70°05'56.8''W, 380m, 08.xii.2005 (J. Grados); 2 males, Madre de Dios , CICRA, Río Los Amigos, 12°33'36.3''S, 70°06'17.3''W, 380m, 09.xii.2005 (J. Grados); 7 males, idem except, 10.xii.2005; 1 female, idem except, 23.vii.2006 (A. Asenjo ); 1 male, idem except, 26.vii.2006; 1 female, idem except, 28.vii.2006; 1 male, idem except, 02.viii.2006; 1 male, idem except 15.ix.2006; 1 male, idem except, 13.i.2007; 2 males, idem, except, 19.i.2007; 2 males, idem except, 21.i.2007; 1 male, 1 female, Alto Madre de Dios , Albergue Pantiacolla, nr. 12°47'S, 71°13'W, 450m, 30.ix–03.x.1998 (J. Grados); 1 male, Río Alto Madre de Dios , nr. Atalaya, 12°53'S, 71°22'W, 587m, 01.v.2006 (P. Centeno); 1 female, idem except, 16.ii.2007; 1 male, 1 female, idem except, 17.ii.2007; 1 male, idem except, 18.ii.2007; 2 males, idem except, 20.ii.2007; 2 males, 1 female, idem except, 21.ii.2007; 2 males, Albergue Refugio Amazonas , 12°52'30''S, 69°24'35''W, 231m, 23.ii.2016 (J. Grados); 1 female, idem except, 25.ii.2016; 1 female, idem except, 27.ii.2016; 1 female, Albergue Refugio Amazonas , 12°52'30''S, 69°24'35''W, 231m, 06.iv.2016 (D. Couceiro); 1 male, idem except, 12.iv.2016 (Michael Loia, Gina Loia, Giovana Loia & D. Couceiro); 2 females, idem except, 13.iv.2016; 1 female, idem except, 14.iv.2016; 1 male, 1 female, idem except, 15.iv.2016; 3 females, idem except, 16.iv.2016; 1 female, idem except, 17.iv.2016; 1 female, idem except, 18.iv.2016; 1 female, idem except, 19.iv.2016; 3 females, idem except, 20.iv.2016; 2 males, 5 females, idem except, 21.iv.2016; 2 males, idem except, 27.iv.2016; 1 female, idem except, 30.iv.2016; 1 male, idem except, 03.v.2016; 1 female, idem except, 07.v.2016; 1 female, idem except, 20.v.2016; 1 female, idem except, 27.v.2016; 1 female, idem except, 19.viii.2016; 1 female, idem except, 02.x.2016; 1 male, idem except, 08.x.2016; 1 male, idem except, 20.x.2016; 2 males, idem except, 21.x.2016; 1male, idem except, 22.x.2016.

Diagnosis (male and female): Head and patagia reddish yellow. Tegulae and thorax brown with yellow areas and red scales. Forewing with large reddish brown area of bluish hue at the two proximal thirds: rising from the tornus up to Cu1, where it projects towards the mesal margin reaching M3 and then towards the ectal margin, reaching the intersection of M1 and R4+R5. It projects towards cell R5, comprising the proximal half, and this part being red with brown scales. White costal margin, from the base up to the level of R4+R5 and M1. Creamy translucent hind wings from the middle to the costal margin. The other half is yellow with a soft reddish hue. The new species is recognizable for bearing a reddish brown spot from the joining of R4 y R5, up to the middle area of the R5 cell.

Descrition male ( Figs. 17–18 ) and female ( Figs. 19–20 ). Forewing span: 14–16 mm in males (n=42), 16–17 mm in females) (n=31). Head: Bottom half of the frons brown. Transverse red line rises by its sides up to the base of the antennae. Vertex and upper half of the frons yellow. Occiput with a line of red scales. Proboscis brown. First palpi segment red to the sides and white on the front. Second segment brown on the front and the inner sides and red on the outer sides. Third segment minute, reddish with brown front and inner sides. Antennae brown, except for the scape and pedicel, with red scales at the base of the flagellum and white ones at the distal forth part. The rami are minute. In female, the antennae are thinner. Thorax: Patagia reddish yellow, due to disperse presence of scales of both colors. A marked red spot at the antero–lateral area. Tegula brown with red scales at the postero–lateral part. Yellow spot at the mesal margin of the anterior part, limited by a red edge. Brown mesoscutum, with the anterior part yellow, speckled which presents red scales. A longitudinal line of red scales at the central part. Posterolateral part with white and red scales. Brown mesoscutellum. Metascutum covered with reddish hair and metascutellum red. First pair of legs white, with the front part of the coxa, the mesal area of the femur and tibia, red. Ectal area of the three first tarsal segments red. The last two red. Second and third pair of legs white.

Forewing; Dorsal surface with a large reddish brown area with a soft purple reflection, that covers two thirds of the wings, from the base to the external margin. The edge of the spot, towards the external margin delimited with red scales. The limit of the area reaches the tornus, rising up to Cu1, from where it projects towards the mesal margin reaching M3, to go to the ectal margin, reaching the intersection of M1 and R4+R5. It projects to R5-M1, covering the proximal half, this part being red with brown scales. Costal margin white, from the base up to the level of R4+R5. From this point, up to the apex, brown. Under the costal margin, from the middle up to the external margin, very close to the apex, presence of a thin red line. Another red thin line over R. Third external part of the wing, towards the margin, yellow with three brown dots. Each one in the respective cell R5-M1, M1-M2-M. Disperse reddish scales at the base of the wing and a red spot at the base of the anal cell. Ventral surface with costal margin white, from the base of the wing up to the beginning of the M1, and from there up to the apex, turning broader and brown. A large red spot comprising the anterior part of the discal cell and the proximal areas of cells M2-M3 and M3- Cu1, projects towards the posterior part, covering like a thin line the middle part of Cu1-Cu2, the distal part of Cu-1A and the distal part of 1A-2A, reaching the tornus. Tornus with yellow scales. A brown spot in the proximal part of the M1-M2. An area with whitish scales comprises the posterior part of the discal cell, the posterior and proximal half of Cu1-Cu2, almost all Cu2-1A, 2A-1A and the anal cell. Three small brown spots located on each of cells R5-M1, M1-M2 and M2-M3. Hindwing: Rounded. Dorsal surface with the area from the costal margin, the discal cell to M3- C1, with creamy scales; an elongated area in the proximal half of Cu1-Cu2 and the proximal area of M3-Cu1, semihyaline; the rest of the wing, with cream and red scales. In females, the hindwings oblong and the dorsal surface reddish. Ventral surface yellow, semihyaline in the proximal half of Cu1-Cu2 and the proximal area of M3- Cu1. Abdomen: Red with a white point at the anterior central part of the first tergite. White scales present on the posterolateral parts from the fourth to seventh tergite. White scales at the posterior part of the last tergite. White ventrally. Male genitalia ( Figs. 21–24 ) (Genitalia # JGA 767): Uncus elongated, setose and lightly curved downward ventrally at the tip. Sacculus elongated, with setae along its margin, being more abundant towards the distal extreme. Ventral process small, oval and membranous. Dorsal process elongated, curved and thin, being three times larger than the ventral process. It bears setae on its distal extreme. Juxta elongated. Transtilla broad, reaching half of the width of each sacculus. Caecum penis short. Vesica short, expanding towards the ventral part; and with a short and thin extension towards the dorsal part.

Etymology: ocassus is an adjective in singular nominative which means sunset. It is an allusion to the wing color.

Distribution: Known only from the department of Madre de Dios, southeast of the Peruvian Amazon. At the moment, its area of distribution includes the Tambopata River and the Madre de Dios River. Evius ocassus is common in its type locality.

Barcoding: The access number to Genbank is MG837874 . The mitochondrial DNA sequence (COI) of one of the paratypes is as follows (Voucher MUSM– Arctiinae VB # 86):

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACTTCATTAAGACTATTAATTCGTGCA GAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATCTATAATACTATTGTAACTGCCCATGCTT TTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATT AGGAGCTCCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGACTTCTGCCCCCTTCTTTAACA TTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTC TTCCAATATTGCTCACGGAGGAAGATCTGTAGACCTAGCTATTTTTTCTCTTCATTTAGCTGGAATCTCA TCAATTTTAGGGGCAATTAATTTTATCACTACAATTATCAATATACGACTAAATAATTTATCATTTGACCA AATACCACTATTTGTGTGAGCCGTCGGAATTACTGCATTTTTATTATTATTATCTTTACCTGTATTAGCAG GAGCTATTACTATATTATTAACTGACCGAAATCTAAATACATCTTTTTTCGACCCAGCAGGTGGGGGTG ATCCTATTCTTTATCAGCATTTATTT

Remarks: Evius ocassus is very similar to E. roseosimulans Coenen & Gibeaux, 2013 which has recently been described from from French Guiana. The new species differs from it in the reddish brown spot on the junction of R4 and R5, going up to the middle area of cell R5-M1, which is not observed in E. roseosimulans . Both species also differ in the genitalia, where the proportion of the sizes of ventral and dorsal processes of the valvae. While in E. roseosimulans the dorsal process is less than double the size of the ventral one, in Evius ocassus n. sp. the dorsal process is three times that of the ventral.

Another species resembling E. ocassus is E. cochenouri Schaus, 1910 , described from Juan Viñas, El Sitio ( Costa Rica). This species is easy to tell apart from E. ocassus because E. cochenouri has yellow patagia, while they are reddish yellow; in E. cochenouri has a reddish brown area not reaching tornus of forewings, whereas in E. ocassus it does.

Figures

FIGURES 17–20. Evius ocassus Grados new species. 17. Holotype male, dorsal. 18. Holotype male, ventral. 19. Paratype female, dorsal (Albergue Refugio Amazonas). 20. Paratype female, ventral. Scales=10 mm.

FIGURES 21–24. Genitalia of Evius ocassus Grados, new species. (Genitalia # JGA–767). 21. Dorsal view. 22. Ventral view. 23. Lateral view. 24. Aedeagus. Scales= 1 mm.