Apanteles ahuacatl Shimbori, Giacomelli & Fernández-Triana, 2023

Shimbori, Eduardo Mitio, Giacomelli, Arthuro De Castro Stolf, Fernández-Triana, José L., Watanabe, Isabela Midori, Santos, Eliaber Barros, Santos, Jakeline Maria Dos, Fazolin, Wilian Xavier & Penteado-Dias, Angélica Maria, 2023, The Apanteles adelinamoralesae species group (Hymenoptera, Braconidae) from Brazil, with descriptions of three new species reared from fruit borers (Lepidoptera, Depressariidae), Zootaxa 5277 (2), pp. 339-362 : 351-352

Apanteles ahuacatl Shimbori, Giacomelli & Fernández-Triana sp. n.

( Figure 10 )

Type material. Holotype, female

Type locality. BRAZIL, São Tomás de Aquino — MG, Café Total farm, 1000m, 20°52′30″ S, 47°07′30″ W, commercial avocado orchard .

Type specimen, female ( DCBU 509717 ) “ BRASIL, S„o Tomás de Aquino — MG, fazenda Café Total, 1000m, 20°52′30″ S, 47°07′30″ W; 31.vii.2018 —Emergence 11.viii; Gonçalves J.C. col. [1-7.18-F27-5]”

Paratypes. Point mounted: 1 male, same as holotype ( DCBU 509718 ) ; 2 females, 2 males, same data as holotype except : 1 female “ 25.viii.2018 — Emergence 08.ix.2018 ” ( DCBU 509719 ); 1 female “ 8.x.2018 — Emergence 22.x.2018 ” ( DCBU 509720 ); 1 male, “ 25.ix.2018 — Emergence 02.x.2018 ” ( DCBU 509721 ); 1 male “ 8.x.2018 — Emergence 15.x.2018 ” ( DCBU 509722 ); 1 female “ Brazil, S„o Paulo, Cap„o Bonito. 20.iv.2004. Adalton col. Ex. Persea americana fruit” ( MZSP 115409 )

In alcohol: 2 females and 6 males, same as holotype except: 1 male “2-8A.18-F4-2, 10.viii.2018 -Emergence 29.viii” ( DCBU 509723 ), 1 male “3-8B.18-F6-2, 25.viii.2018 — Emergence 10.ix.2018 ” ( DCBU 509724 ), 1 female “3-8B.18-F26-1, 25.viii.2018 — Emergence 6.ix.2018 ” ( DCBU 509725 ), 1 male “4-9A.18-F21-1, 8.ix.2019 — Emergence 17.ix.2018 ” ( DCBU 509727 ); 1 female “4-9A.18-F27, 8.ix.2019 — Emergence 14.ix.2018 ” ( DCBU 509728 ); 1 male “5-9B.18-F6-2, 25.ix.2018 — Emergence 2.x.2018 ” ( DCBU 509729 ), 1 male “5-9B.18-F8-2, 25.ix.2018 — Emergence 2.x.2018 ” ( DCBU 509730 ), 1 male “6-10A.18-F12-1, 8.x.2018 — Emergence 15.x.2018 ” ( DCBU 509731 ); 1 female “ Brazil, Minas Gerais, S„o Thomé das Letras, Fazenda Divisa, -21.735521, -45.052279, 31/I/2022. Ex. Stenoma catenifer in avocado. Fazolin W.X. col.” ( DCBU 509732 ); 1 male “ Brazil, S„o Paulo, Timburi, Fazenda Santa Eliza, -23.2352899, -49.5783910. Ex. Stenoma catenifer in avocado var. Margarida. Col. 24.IX.2022. Emergence 05.X.2022. Fazolin W.X. col.” ( DCBU 509733 ) .

Description. Female. Body color: antenna, head, mesosoma and metasoma black, except hypopygium mostly transparent; ventral half of mesopleuron laterally, occasionally pale. Fore leg mostly yellow, coxa, trochanter, trochantellus and basal 0.1-0.2 of femur black; mid leg similar but femur with basal 0.5-0.6 black, and spurs white, 5th tarsus dark; hind leg black except basal 0.6-0.7 of tibia orange-yellow and spurs white, tarsi darker apically (5th tarsus dark). Tegula and humeral complex color: tegula pale, humeral complex half pale/half dark. Pterostigma color: mostly pale and/or transparent, with thin dark borders. Fore wing veins color: mostly white/transparent, parastigma and vein R1 dark. Antenna length/body length: antenna about as long as body: 0.9-1.0. Body in lateral view: not distinctly flattened dorso–ventrally. Body length (head to apex of metasoma): 2.9–3.3 mm. Fore wing length: 3.1–3.3 mm. Ocular–ocellar line/posterior ocellus diameter: 1.8–2.0. Interocellar distance/posterior ocellus diameter: 1.6–1.8. Antennal flagellomerus 2 length/width: 2.5–2.8. Tarsal claws: with one spine like basal setae. Metafemur length/width: 2.9–3.1. Metatibia inner spur length/metabasitarsus length: 0.5–0.6. Anteromesoscutum: mostly with deep, dense punctures (separated by less than 2.0 × its maximum diameter). Mesoscutellar disc: mostly smooth, with sparse setal punctures laterally. Number of pits in scutoscutellar sulcus: 12. Maximum height of mesoscutellum lunules/maximum height of lateral face of mesoscutellum: ~0.8. Propodeum areola: completely defined by carinae, including transverse carina extending to spiracle. Propodeum background sculpture: partly sculptured, especially on anterior 0.5. Mediotergite 1 length/width at posterior margin: 1.1–1.2. Mediotergite 1 shape: more or less parallel–sided. Mediotergite 1 sculpture: entirely sculptured—rugose. Mediotergite 2 width at posterior margin/length: 3.8–4.5. Mediotergite 2 sculpture: mostly smooth. Outer margin of hypopygium: with a wide, medially folded, transparent, semi-desclerotized area; with several pleats (10+). Ovipositor thickness: about same width throughout its length. Ovipositor sheaths length/metatibial length: 1.0–1.1. Length of fore wing veins r/2RS: 1.7–1.9. Length of fore wing veins 2RS/2M: 1.5–1.8. Length of fore wing veins 2M/(RS+M)b: 0.45–0.60. Pterostigma length/width: 2.9–3.1. Point of insertion of vein r in pterostigma: slightly to distinctly passed halfway point (more distal/apical) length of pterostigma. Angle of vein r with fore wing anterior margin: more or less perpendicular to fore wing margin. Shape of junction of veins r and 2RS in fore wing: not angled. Vannal lobe of hind wing margin entirely devoid of setae and distinctly concave.

Male. Darker than female; the hind tibia is usually mostly to entirely black. Antenna longer than body: 1.1–1.3. Body length 2.2–3.2 mm; fore wing length 2.9–3.2 mm.

Molecular data. The sequences of DNA barcoding obtained for this species were submitted to BOLD systems and have been matched to Apanteles Rodriguez 127 (access code: ASBD019-07) with a similarity of 99.54%. This is one of the species mentioned by Fernández-Triana et al. (2014), that were not described due to the poor condition of the specimens and/or absence of females. The specimen from Costa Rica was collected from ACG by sweeping, therefore there is no information regarding the biology of this species in Costa Rica. The voucher codes of this specimen in the ACG project are DHJPAR0012512 and 06-SRNP-98014. The sequence of Apanteles Rodriguez 127 (= A. ahuacatl sp. n.) was the single one attributed to BIN BOLD:AAK1559.

DNA Barcode (Holotype and one paratype: DCBU 509718 ) :

AATTTTATATTTCATATTTGGAATATGATCAGGAATATTAGGATTCTCAATAAGATTAATCATTC GTTTAGAATTAGGAACACCTGGTTCATTAATTGGTAATGACCAAATTTATAATAGAATTGTTAC ATCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGTGGATTTGGAAATT GATTAGTTCCATTAATATTAGGAGCCCCTGATATATCATTTCCACGAATAAATAATATAAGATT TTGATTATTAATTCCTTCTTTATTTTTATTAGTATTTAGAGGATTTATTAATACAGGAGTAGGGA CAGGATGAACAGTATACCCCCCTTTATCCTTAATTTTAGGCCATGGTGGAATATCAGTAGATAT AGGTATTTTTGCATTACATTTAGCAGGAGCATCCTCAATTATAGGGGCAATTAATTTTATTACT ACAGTTTTAAATATACGAGTTAATCTATTTATTATAGATAAAATATCACTATTTATTTGATCAGT TTTTATTACAGCTATTTTATTATTACTATCTTTACCTGTTTTAGCAGGTGCTATTACAATATTATT AACTGACCGAAATCTAAATACAAGTTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATA TCAACACTTATTT

Biology/ecology. Solitary parasitoid of Stenoma catenifer Walsingham ( Depressariidae , Stenomatinae ) in avocado fruits, Persea americana (Lauraceae) . This parasitoid likely attacks early instar larvae. Its development from collection until pupation usually took 0 to 15 days, supporting the hypothesis of the parasitism occurring in early instar stages of the host larvae, which has a mean larval period of 27 days ( Nava et al. 2005b). Pupation occurred usually inside the fruit or under avocado seeds when in the laboratory-rearing system of the host. Time from pupation until adult emergence was 5 to 7 days. During the rearings, one secondary parasitoid identified as Perilampus sp. ( Hymenoptera , Perilampidae ) ( Darling 2006) emerged from the cocoon of Apanteles ahuacatl sp. n. collected in Timburi, SP, Brazil by Fazolin W.X. on February 18th, 2022.

Distribution. Brazil: Minas Gerais and S„o Paulo states; Costa Rica: ACG.

Etymology. The species name is the Nahuatl/Mexicano word for avocado.

Comparative diagnosis. The species is similar to A. isaacbermudezi in having a mostly yellow metatibia (at least basal half—usually more, but males mostly dark brown), and ovipositor sheaths about as long as metatibia (relatively short as compared with other species in this group). The new species is distinct from A. isaacbermudezi in having relatively larger ocelli, OOL/OD = 1.8–2.0 (compared to 2.3–2.5 in A. isaacbermudezi ); inner spur/basitarsus: 0.52–0.56 (0.40–0.50 in A. isaacbermudezi ); maximum height of mesoscutellum lunules/maximum height of lateral face of mesoscutellum: 0.8 (0.6–0.7 in A. isaacbermudezi ); mediotergite 1 length/width at posterior margin: 1.1–1.2 (1.7–1.9 in A. isaacbermudezi ); T1 entirely sculptured, rugose (sculptured laterally in A. isaacbermudezi ); mediotergite 2 width at posterior margin/length: 3.9–4.3 (3.2–3.5 in A. isaacbermudezi ); length of fore wing veins 2RS/2M: 1.6 (1.1–1.3 in A. isaacbermudezi ); length of fore wing veins 2M/(RS+M)b: 0.45–0.6 (0.9–1.0 in A. isaacbermudezi ). A dissimilarity of 11.86 % base pairs was found when comparing DNA barcoding data of the two species (BIN BOLD:ABX6156 and BOLD:AAK1559).

Prospects for biological control. The avocado seed borer, Stenoma catenifer , is a key pest of this crop ( Acevedo et al. 1972; Boscán de Martínez & Godoy 1982; 1984). In our preliminary results (unpublished), Apanteles ahuacatl sp. n. was by far the most relevant parasitoid, accounting for 84% of the total parasitism (roughly 30% of total larvae were parasitized), followed by Hypomicrogaster sp. and one unidentified Tachinidae (Diptera) species. The new species was previously obtained in a survey study in the same area in Brazil (S„o Sebasti„o do Paraíso, MG), identified as Apanteles sp. ( Nava et al. 2005a). In that study, Apanteles ahuacatl sp. n. was one of the major larval parasitoids of Stenoma catenifer , after Dolichogenidea sp. Studies from Guatemala ( Hoddle & Hoddle 2008) and Peru ( Hoddle & Hoddle 2012) detected Apanteles sp. as the dominant parasitoid in avocado orchards. However, the species reared in those studies is a gregarious parasitoid, contrasting with the solitary habit of Apanteles ahuacatl sp. n. Interestingly, the dominant species found by Nava et al. (2005a), Dolichogenidea sp. , was also gregarious. This genus is easily confused with Apanteles , and limits for the two genera are sometimes blurred (see Fernández-Triana et al. 2014).

Figures

FIGURE 10. Apanteles ahuacatl sp. n. A, Habitus, lateral view; B, Fore wing; C, Hypopygium and ovipositor sheaths; D, Antenna; E, Head, frontal view; F, Head, dorsal view; G, Meso- and metasoma, dorsal view.