Baylisascaris

Camp, Lauren E., Radke, Marc R., Shihabi, Danny M., Pagan, Christopher, Yang, Guangyou & Nadler, Steven A., 2018, Molecular phylogenetics and species-level systematics of Baylisascaris, International Journal for Parasitology: Parasites and Wildlife 7 (3), pp. 450-462 : 459-460

4.3. Baylisascaris in bears

The first Baylisascaris species was described by Rudolphi in 1819 as Ascaris transfuga . Rudolphi's description was based on specimens from polar bear ( Ursus maritimus ) and brown bear ( U. arctos ). When Sprent (1968) created Baylisascaris , he redescribed A. transfuga , and reported this parasite from six species in Ursinae – U. maritimus , U. arctos , U. thibetanus (syn. U. torquatus ), U. americanus , Helarctos malayanus , and Melursus ursinus . Ascarids from the six ursines (and their numerous subspecies) are typically assumed to be B. transfuga . Spectacled bears ( Tremarctos ornatus, Tremarctinae ) and giant panda ( Ailuropoda melanoleuca, Ailuropodinae ) were not part of this host list for B. transfuga .

the region included corresponds to the highlighted region in Fig. 2 from Franssen et al. (2013).

Species Repeat pattern

B. columnaris isolates GAGAGAGAGAGAGAAAGAGAAA

B. procyonis isolates GAGAGAGAGAGAGAGAGAGAAAGAGAAA

B. devosi CAGAGAGAGAGAGAGAGAAAGAGAAAGAAAGAAAGAGAAAGAA

B. ailuri GAGGGAGAGA

B. schroederi GAGAAGAGA

B. transfuga isolates GAGAAGAGA

B. tasmaniensis GAGAGAGAAAA

Giant pandas are consistently resolved as outside the clade containing other Ursidae ( Yu et al., 2007; Pagès et al., 2008; Nyakatura and Bininda-Emonds, 2012; Kutschera et al., 2014), and are hosts for a distinct Baylisascaris species ( B. schroederi ). Spectacled bears are also commonly resolved as sister to the six ursine species and a new Baylisascaris species specific to T. ornatus was recently described ( B. venezuelensis ; Pérez Mata et al., 2016).

Specimens of Baylisascaris from these six bear species, or their subspecies, have been included in recent molecular phylogenies ( Li et al., 2012; Franssen et al., 2013; He et al., 2013; Tokiwa et al., 2014; Pérez Mata et al., 2016). Importantly, the distributions of these bear species and their subspecies do not usually overlap. For a variety of genes and inference methods, Baylisascaris specimens from ursine hosts are monophyletic, but with clade support ranging from absent ( Pérez Mata et al., 2016) to high ( Li et al., 2012; He et al., 2013; Tokiwa et al., 2014). Based on mitochondrial ND1, He et al. (2013) concluded that Baylisascaris from polar bear, an Asian black bear subspecies (U. t. mupinensis), and two subspecies of the brown bear (Ussuri and Tibetan blue) were all B. transfuga . These analyses provide a start to assessing species validity of Baylisascaris from bears, but none of them explicitly tested the hypothesis of multiple species (including cryptic species) of Baylisascaris in ursine hosts. The historical biogeography of certain bear species is consistent with the isolation and allopatric speciation of their nematode parasites (Catalano et al., 2015). For example, the hookworm species Uncinaria rauschi and U. yukonensis are believed to have originated, respectively, in the Nearctic (with black bears) and Palearctic (with grizzly bears), during millions of years of geographic isolation of their hosts ( Rausch et al., 1979). Such biogeographic histories could likewise influence the speciation of Baylisascaris in bears.

Our analysis included B. transfuga from two North American bear species – grizzly bear ( U. arctos horribilis , Alberta, Canada) and American black bear ( U. americanus , West Virginia, USA). Unlike previous studies, specimens of B. transfuga from these hosts were not monophyletic in any trees based on single genes or combined sequence data. Pairwise distance values between B. transfuga ALB and B. transfuga WV were higher than values between B. transfuga ALB and B. schroederi for all genes except msp and ard1 ( Tables S4 and S6). Baylisascaris transfuga ALB was usually sister to B. schroederi , which suggests that the Baylisascaris specimens from grizzly and black bears may be different species. However, the alternative topology test depicting monophyly of B. transfuga isolates was not significantly worse than monophyly of B. schroederi and B. transfuga ALB for any combined dataset (Table S10). These results indicate that more research to test the hypothesis of multiple species of Baylisascaris from these and other bears is warranted. When choosing a sample size, investigators should consider the possibility that a single host species might be infected with multiple cryptic species of Baylisascaris , and sample from wild hosts throughout their ranges, rather than captive or zoo-kept hosts, which could host aberrant species.

4.4. Relationships of Baylisascaris species with their hosts in Arctoidea ( Carnivora )

Nine Baylisascaris species infect arctoid carnivorans as definitive hosts – B. transfuga , B. columnaris , B. melis , B. schroederi , B. procyonis , B. devosi , B. ailuri , B. potosis , and B. venezuelensis . Six of these species were included in the multigene phylogenetic analyses conducted herein, which resolved two strongly supported Baylisascaris clades, consistent with previous analyses. Additional single gene analyses included sequences from B. potosis (cox 1, 28S, and ITS2; Tokiwa et al., 2014) and B. venezuelensis (ITS; Pérez Mata et al., 2016) as well as additional sequences of B. devosi (cox1, Nemeth and Tannis, 2014; cox 1, 28S, and ITS, Tranbenkova and Spiridonov, 2017). Clade 1 includes parasites from musteloid hosts native to North America, Central America, and Eurasia ( B. columnaris , B. procyonis , and B. devosi ), and one species ( Fig. S1-3 , B. potosis ) from a musteloid host (kinkajou) occurring in both North and South America. Baylisascaris ailuri , a member of clade 2, also infects a musteloid, the red panda ( Ailurus fulgens ), but this host species is native to China. Baylisascaris ailuri was part of Baylisascaris clade 2 that includes parasites from ursid hosts. Support for monophyly of B. ailuri + ursid Baylisascaris spp. was strong among datasets ( Figs. 1–3 , Figs. S1 , and S2, Tables S7 and S8). Previous phylogenetic analyses have not provided strong support for relationships between B. ailuri and other ursid Baylisascaris spp. ( Xie et al., 2011a; Franssen et al., 2013; Tokiwa et al., 2014). Cophylogeny would predict monophyly of B. ailuri and the other Baylisascaris species from musteloid hosts, but this is falsified by the phylogeny. The red panda range in China has overlapped that of two ursid Baylisascaris hosts – A. melanoleuca (giant panda) and Ursus thibetanus (Asian black bear) – and is close to the range of Melursus ursinus (sloth bear) ( IUCN, 2016). Biogeography and host colonization (switching) have likely both been important factors in determining host-parasite associations in this assemblage. The general absence of cospeciation suggests important roles for factors such as ecological fitting, taxon pulses, and oscillation ( Hoberg and Brooks, 2008, 2010) in determining host-parasite associations of Baylisascaris species.

In the clade of Baylisascaris from North American musteloids, cophylogeny would predict a sister group relationship between B. procyonis from raccoons and B. devosi from fishers. Instead, B. devosi is sister to B. potosis ( Tranbenkova and Spiridonov, 2017) and B. procyonis and B. columnaris are strongly supported as a clade in phylogenetic analyses. Interpretation of this result depends on the status of B. procyonis and B. columnaris as separate species. Biogeography and host colonization may also play a role in the close relationship of these species. For example, raccoons and skunks currently overlap for most of their North American distributions but overlap less with hosts of B. devosi (fishers, martens, and wolverines) ( IUCN, 2016).

Figures

Fig. 2. Bayesian consensus tree based on FULL data from nuclear genes (5 genes; not including hars1). Branch lengths are scaled to the expected number of substitutions per site. Numbers above nodes represent Bayesian posterior probabilities, shown when 0.90 and greater.

Fig. 1. Bayesian consensus tree based on combined FULL data (8 genes; not including hars1). Branch lengths are scaled to the expected number of substitutions per site. Numbers above nodes are Bayesian posterior probabilities, shown when 0.90 and greater.

Fig. 3. Bayesian consensus tree based on FULL mitochondrial gene sequences (3 genes). Branch lengths are scaled to the expected number of substitutions per site. Numbers above nodes represent Bayesian posterior probabilities, shown when 0.90 and greater.