Heliopetes (Heliopetes) lana Grishin, 2023

Zhang, Jing, Cong, Qian & Grishin, Nick V., 2023, Supplementary Materials and Appendix, Insecta Mundi 2023 (26), pp. 1-115 : 37-38

Heliopetes (Heliopetes) lana Grishin , new species

https://zoobank.org/ 2E6992E1-9CAE-4FF2-AD84-B73CB2C57F00

( Fig. 3 part, 83–84, 302–303)

Definition and diagnosis. Phylogenetic analysis reveals that specimens from North America identified as Heliopetes alana (Reakirt, 1868) (type locality in Colombia, syntype sequenced as NVG-15039C04, sequence completeness insufficient to add it to the Z chromosome tree) are not monophyletic with it and instead are sister to both H. alana and Heliopetes chimbo Evans, 1953 (type locality in Ecuador), exhibiting notable genetic differentiation ( Fig. 3): e.g., COI barcodes of a specimen from Guatemala and Colombia differ by 2% (14 bp). All available names in synonymy with H. alana have type localities in South America. Therefore, the North American populations are a new species. This new species keys to H. alana (G.2.12) in Evans (1953) and differs from its relatives by the following combination of characters: typically whiter (i.e., less yellow), especially on ventral hindwing ( Fig. 84, but due to extensive variation hardly identifiable by facies), rounder in dorsal view anterior margin of tegumen, more extended harpe and, correspondingly, longer expansion of ampulla ( Fig. 302–303). Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1079.16.3:T70C, aly173.27.12:C85T, aly173.27.12:A144G, aly276665.11.2:T224G, aly276665.11.2:A302T, and COI barcode: A229G, C235T, A289A, T397C, A477G, T557C.

Barcode sequence of the holotype. Sample NVG-17109G07, GenBank OR837660, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATT GGAGATGATCAAATTTATAATACTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTCATAGTAATACCAATTATAATTGGAGGATTTGGAAATT GATTAGTACCTTTAATATTAGGAGCCCCAGATATGGCATTTCCTCGTATAAATAATATAAGATTTTGACTTTTACCCCCATCCCTAACATTATTAAT TTCAAGAAGTGTAGTAGAAAATGGAGCAGGAACTGGTTGAACAGTTTACCCCCCTCTCTCGGCTAATATTGCCCATCAAGGATCTTCTGTTGATTTA GCTATTTTCTCTTTACATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGTATTAGAAGTATATCAT TTGATCAAATACCTTTATTTGTATGAGCGGTAGGAATTACTGCTTTATTACTACTATTATCATTACCTGTTCTAGCAGGTGCCATTACAATATTATT AACAGATCGAAATTTAAATACATCATTCTTCGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTC

Type material. Holotype: ♂ deposited in the Los Angeles County Museum of Natural History, Los Angeles, CA, USA ( LACM), illustrated in Fig. 83–84, bears the following three rectangular labels, two white: [ GUATEMALA. Peten District | Finca Ixobel S of Poptun | 16° 18’ 14” N: 89° 25’ 20” W | 5-10 JUNE 2003: 1700 ft. | Ron Leuschner. coll.], [DNA sample ID: | NVG-17109G07 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Heliopetes | lana Grishin ] . Paratypes: 2♂♂: 11-BOA-13383A02 the same data as the holotype [ USNM] and NVG-20062H06 Mexico: Tamaulipas, 1–4 km N of Gomez Farias, 350 m, 17-Aug-1972, C. J. Durden leg. (genitalia Fig. 302–303) [ TMMC].

Type locality. Guatemala: Peten District, Finca Ixobel S of Poptún, elevation 1700 ft, GPS 16.3039, −89.4222. Etymology. The name removes a negating “a” from the name of its more southern sister species H. alana and is a feminine noun in apposition.

Distribution. This species is currently known from Mexico and Guatemala but is expected from other Central American countries.