taxonID	type	description	language	source
0384230AFFF0FFD28747FAC8FBBBFE65.taxon	description	For the specimens fixed in ethanol, DNA was extracted from caudalfin clips using the Macherey and Nagel NucleoSpin 96 Tissues kit following the manufacturer's instructions on an Eppendorf epMotion 5075 robot. A mitochondrial fragment of the COI gene (650 base pair [bp]) was amplified using the tailed fish specific primers VF 2 - t 1 5 0 - TGTAAAACGACGGCCAGTCAACCAACCACAGACATTGGCAC- 3 0; Fis hF 2 - t 1 5 0 - TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCG GCAC- 3 0; Fishr 2 - t 1 5 0 - CAGGAAACAGCTATGACACTTCAGGGTGAC CGAAGAATCAGA- 3 0 (Ward et al., 2005); Fr 1 d-t 1 5 0 - CAGGAAACAG CTATGACACCACAGGGTGTCCGARAAYCARAA- 3 0 (Ivanova et al., 2007). DNA was amplified using PCR in a final volume of 20 μL containing 2 μL of buffer, 1 μL of dimethyl sulfoxide (DMSO), 1 μL of bovine albumin serum (BAS), 0.8 μL of deoxynucleotide triphosphates, 0.32 μL of each forward and reverse primer, 0.06 μL of Taq DNA polymerase (Qiagen), 2 μL of DNA, and water. DNA was amplified using a thermal cycler (T 100 TM Thermal Cycler) after 2 min of denaturation at 94 C followed by 55 cycles (30 s, 94 C; 45 s, 54 C; 1 min, 72 C). Successful PCRs were selected on ethidium bromide – stained agarose gels. Sanger sequencing was performed in both directions by Eurofins (http: // www. eurofins. fr) using M 13 tail primers M 13 F (21) 5 0 - TGTAAACGACGGCCAGT- 3 0; M 13 R (27) 5 0 - CAGGAAACAGC- TATGAC- 3 0 (Messing, 1983).	en	Haÿ, Vincent, Mennesson, Marion I., Carpentier, Camille, Dahruddin, Hadi, Sauri, Sopian, Limmon, Gino, Wowor, Daisy, Hubert, Nicolas, Keith, Philippe, Lord, Clara (2025): Phylogeography of Microphis retzii (Bleeker, 1856) and Microphis brachyurus (Bleeker, 1854) in the Pacific. Journal of Fish Biology 106 (2): 602-620, DOI: 10.1111/jfb.15981, URL: https://doi.org/10.1111/jfb.15981
0384230AFFF4FFD88747FA0DFE90FAEA.taxon	description	3.1.1 | Phylogeography A total of 91 sequences (480 bp) were successfully generated and aligned. Ten haplotypes (H 1 – H 10) were identified, including seven unique haplotypes observed in a single individual (H 2, H 3, H 4, H 5, H 7, H 8, and H 9) (Figure 2; Table S 1). The haplotype network for M. brachyurus has two main haplogroups separated by five nucleotide substitutions (Figure 2 a). Haplogroup 1, composed of haplotypes H 1 – H 9, includes individuals from Papua New Guinea (New Britain), Indonesia (Borneo), Solomon Islands (Kolombangara and Isabel), Japan (Okinawa), and New Caledonia. Haplogroup 1 presents a star-like topology, with a central haplotype (H 1) shared by several individuals from most sampling sites and radiating into eight haplotypes separated by a single or two mutations from H 1. Haplogroup 2 is composed of one unique haplotype H 10 carried by individuals from French Polynesia (Tahiti) only. There are no shared haplotypes between the two haplogroups. The different sampling sites of M. brachyurus were grouped into two large geographical areas to match the spatially nested design of the AMOVA: WPO and CPO (Figure 2 b), corresponding to the two haplogroups mentioned earlier. Hd and π are higher in the WPO zone (Hd = 0.667; π = 0.927) compared to the CPO zone (Hd = 0.117; π = 0.117). The values of Fu's F and Tajima's D are significantly negative for the WPO region (Table 2). The spatial genetic structuring of M. brachyurus observed in Figure 2 is supported by a high and statistically significant Φst value (0.914) between CPO and WPO zones (p <0.05). The average genetic distance between and within CPO and WPO was calculated from the uncorrected p-distances matrix with a value of 1.26 % between regions and low genetic distances on average within regions, that is, 0.17 % – 0 % (Table 3). 3.1.2 | MOTUs delimitation and phylogenetic analysis DNA-based species delimitation methods resulted in congruent delimitation schemes with two MOTUs for sPTP and ASAP, and one MOTU for mPTP and sGMYC (Figure 3, Table S 2). mGMYC were not Geographical areas N Fst Hd h π WPO 44 0.913 0.667 2 0.927 CPO 47 0.916 0.117 10 0.117 T A B L E 2 Molecular diversity indices Fu's F Tajima's D for Microphis brachyurus. 6.083 1.557 0.521 0.791 Note: Significant values (p - value <0.05) are indicated in bold. Abbreviations: CPO, Central Pacific Ocean; F and D, neutrality tests; Fst, intra-zone differentiation parameter; Hd, haplotype diversity; h, number of haplotypes; π, nucleotide diversity; N, number of individuals sampled; WPO, West Pacific Ocean. WPO CPO WPO 0.17 CPO 1.26 0 Note: Intra-zone divergences are presented in bold. available for this dataset; the Markov chain failed to run for the multiple threshold version of GMYC with splits. The final consensus scheme consisted of two MOTUs in the Pacific area: one for the West Pacific (Indonesia, Japan, New Caledonia, Papua New Guinea, and Solomon Islands) and one for the Central Pacific (French Polynesia). These two MOTUs were assigned to the same nominal species, M. brachyurus (Bleeker, 1854), according to the low genetic divergence (1.26 %) (Table 3). The Bayesian gene tree, based on the MOTUs recognized here, suggests a recent diversification of the M. brachyurus mitochondrial lineages (Figure 3). Among the 10 haplotypes, 2 lineages are recognized within M. brachyurus, one is restricted to the Central Pacific (H 10 in French Polynesia) and one is shared in the West Pacific area (H 1 – H 9 from Japan to New Caledonia) with a most recent common ancestor (MRCA) dated around 0.43 MYA (95 % HPD: 0.1754 – 0.759) (Figure 3).	en	Haÿ, Vincent, Mennesson, Marion I., Carpentier, Camille, Dahruddin, Hadi, Sauri, Sopian, Limmon, Gino, Wowor, Daisy, Hubert, Nicolas, Keith, Philippe, Lord, Clara (2025): Phylogeography of Microphis retzii (Bleeker, 1856) and Microphis brachyurus (Bleeker, 1854) in the Pacific. Journal of Fish Biology 106 (2): 602-620, DOI: 10.1111/jfb.15981, URL: https://doi.org/10.1111/jfb.15981
0384230AFFFAFFD88747FAC8FAE7F92D.taxon	description	3.2.1 | Phylogeography An alignment of a total of 30 sequences (605 bp) was obtained. Fourteen haplotypes (H 1 – H 14) were identified, including seven unique haplotypes represented by a single individual H 1, H 4, H 5, H 6, H 8, H 11, and H 12 (Figure 4; Table S 1). The haplotype network of M. retzii showed three distinct haplogroups separated from each other by several mutations and reconstructed haplotypes (Figure 4 a). Haplogroups 1 and 2 are separated from each other by 23 mutations and one hypothetical haplotype. Haplogroups 1 and 3 are separated from each other by 16 mutations and one hypothetical haplotype. Haplogroups 2 and 3 are separated from each other by 39 mutations and two hypothetical haplotypes. Haplogroup 1, composed of haplotypes H 1 – H 5, includes individuals from Maluku islands (Ambon and Ceram), Sulawesi, and Papua. Haplogroup 2 is composed of haplotypes H 6 – H 12, which includes individuals from the Sunda Shelf (Bali and Java) and Lesser Sunda islands (Lombok). Finally, haplogroup 3, composed of haplotypes H 13 and H 14, includes individuals from the North Pacific (Taiwan and China). The different localities sampled for M. retzii were partitioned in three large geographical areas, including NPO, WI (Maluku Islands, Sulawesi, and Papua), EI (Sunda Shelf) (Figure 3 b). Hd is highest for EI (0.8) and lowest for NPO (0.6). π is highest for NPO (3) and lowest for WI (0.836) (Table 4). Fu's F and Tajima's D tests were not significant (Table 4). The spatial genetic structuring of M. retzii observed in Figure 3 is supported by high and statistically significant (p <0.05) Φst values between each zone (Table 5). The highest Φst value (0.964) is observed between WI and EI, and the lowest Φst value (0.906) is observed between EI and NPO. The percentages of divergence between the populations of the three zones vary between 3.3 % and 5.1 % (x genetic distance), with shallow divergence among populations ranging from 0.2 % to 0.4 % (Table 6). 3.2.2 | MOTUs delimitation and phylogenetic analysis DNA-based species delimitation methods resulted in congruent delimitation schemes with three MOTUs for mPTP, sGMYC, and ASAP and four MOTUs for sPTP and mGMYC (Figure 5; Table S 2). The final consensus scheme consisted of three MOTUs in Southeast Asia: one for EI (Ceram, Ambon, Sulawesi, Papua), one for WI (Lombok, Bali, Java), and one for the NPO (China, Taiwan). These three MOTUs were assigned to one nominal species M. retzii (Bleeker, 1856). However, the main pair-wise divergences between these MOTUs are relatively high, between 3.3 % and 5.1 % (Table 6). The Bayesian gene tree, based on the MOTUs recognized here, suggests a diversification of M. retzii MOTUs around 1.8 MYA (Figure 5). Among the 14 haplotypes recognized within M. retzii, three lineages are observed: one is restricted to EI (H 1 – H 5) with an MRCA dated around 0.42 MYA (95 % HPD: 0.166 – 0.7217); one is restricted to the NPO (H 13 and H 14) with a MRCA dated around 0.27 MYA (95 % HPD: 0.0503 – 0.5411); and one is restricted to WI (H 6 – H 12) with an MRCA dated around 0.33 MYA (95 % HPD: 0.1237 – 0.5862) (Figure 5).	en	Haÿ, Vincent, Mennesson, Marion I., Carpentier, Camille, Dahruddin, Hadi, Sauri, Sopian, Limmon, Gino, Wowor, Daisy, Hubert, Nicolas, Keith, Philippe, Lord, Clara (2025): Phylogeography of Microphis retzii (Bleeker, 1856) and Microphis brachyurus (Bleeker, 1854) in the Pacific. Journal of Fish Biology 106 (2): 602-620, DOI: 10.1111/jfb.15981, URL: https://doi.org/10.1111/jfb.15981
0384230AFFFBFFDB8747FA2FFEEEFAEA.taxon	description	NPO East Indonesia West Indonesia N 5 15 10 Fst Hd h π Fu's F Tajima's D 0.941 0.6 2 3 3.526 1.685 0.949 0.8 7 1143 0.216 0.301 0.951 0.69 14 0,836 0.116 0.627 Note: Significant values (p - value <0.05) are indicated in bold. Abbreviations: N, number of individuals sampled; NPO, North Pacific Ocean; Fst, intra-zone differentiation parameter; Hd, haplotype diversity; h, number of haplotypes; π, nucleotide divers; F and D, neutrality tests. NPO East Indonesia West Indonesia NPO East Indonesia 0.906 West Indonesia 0.952 0.964 Note: Significant values (p - value <0.05) are presented in bold. Abbreviation: NPO, North Pacific Ocean.	en	Haÿ, Vincent, Mennesson, Marion I., Carpentier, Camille, Dahruddin, Hadi, Sauri, Sopian, Limmon, Gino, Wowor, Daisy, Hubert, Nicolas, Keith, Philippe, Lord, Clara (2025): Phylogeography of Microphis retzii (Bleeker, 1856) and Microphis brachyurus (Bleeker, 1854) in the Pacific. Journal of Fish Biology 106 (2): 602-620, DOI: 10.1111/jfb.15981, URL: https://doi.org/10.1111/jfb.15981
0384230AFFFBFFDB8747FA2FFEEEFAEA.taxon	materials_examined	East Indonesia West Indonesia NPO East Indonesia 0.4 West Indonesia 4.44 0.2 NPO 3.3 5.1 0.4 Note: Intra-zone divergences are presented in bold. connectivity of these different groups on a global scale, and define more precisely their taxonomic status. We therefore corroborate Dawson's (1979) findings.	en	Haÿ, Vincent, Mennesson, Marion I., Carpentier, Camille, Dahruddin, Hadi, Sauri, Sopian, Limmon, Gino, Wowor, Daisy, Hubert, Nicolas, Keith, Philippe, Lord, Clara (2025): Phylogeography of Microphis retzii (Bleeker, 1856) and Microphis brachyurus (Bleeker, 1854) in the Pacific. Journal of Fish Biology 106 (2): 602-620, DOI: 10.1111/jfb.15981, URL: https://doi.org/10.1111/jfb.15981
0384230AFFF9FFDD8747FAC8FE62FA72.taxon	description	The haplotype network obtained for M. retzii revealed three distinct haplogroups: one in EI (Ceram / Ambon / Papua / Sulawesi, haplogroup 1), one in WI (Bali / Java / Lombok, haplogroup 2), and one in the NPO (China and Taiwan, haplogroup 3) (Figure 4), and no haplotypes are shared between these three haplogroups. This phylogeographic pattern suggests at least distinct mitochondrial divergences among these sets of populations as a result of limited connectivity between these regions. It is currently unknown if M. retzii is amphidromous. Haÿ et al. (2023 b) have validated an amphidromous life cycle for Microphis nicoleae, a closely related species to M. retzii, with a relatively short marine phase of 19.7 ± 5.8 days. However, it is important to note that the life cycle of a taxon is not fixed and can vary. The loss of amphidromy is quite common in fish species or populations (Liao et al., 2020; Murase & Iguchi, 2019) and has already been observed in freshwater pipefish (Lord et al., 2024). The marked genetic structuring of these three lineages could be partly explained by biotic factors, such as life-cycle variations (i. e., facultative amphidromy or short marine duration), which limit dispersal and enhance geographic isolation. These three lineages are found in different areas in Southeast Asia, which is divided into several biogeographic subregions (or hotspots), of which three are represented here: the Sunda Shelf (represented by haplogroup 2), Wallacea (represented by haplogroup 1), and Philippines (represented by haplogroup 3) (Woodruff, 2010) (Figure 4). These subregions present complex biogeographical histories, leading to major vicariance events (Hutama et al., 2016; Lohman et al., 2011). Indeed, genetic structuring can be significantly impacted by biogeography and environmental conditions; rapid changes during the geological history of a region can create barriers to dispersal, which in turn limits gene flow (Lohman et al., 2011; Sholihah et al., 2021 a; Sholihah et al., 2021 b; Wibowo et al., 2023). Several events on the scale of geological time have caused successive interruptions of connectivity in Southeast Asia. For example, sea-level fluctuations during the glacial cycles of the Pleistocene (2.7 MAY – 11,700 years) have led to the establishment of geographical barrier by connecting Borneo, Sumatra, and Java to the mainland, a process that happened repeatedly during the late Pleistocene (Sholihah et al., 2021 a; Sholihah et al., 2021 b; Woodruff, 2010). Moreover, the Makassar Strait (known as Wallace's line), between the Sunda Shelf and Wallacea, although known to serve as a marine barrier to the dispersal of land animals to Borneo and Sulawesi, could be involved as a dispersal barrier to marine organisms and therefore lead to the genetic isolation of amphidromous species. For instance, sharp genetic breaks were described for populations of the mantis shrimp Haptosquilla pulchella among these oceanographic regions, suggesting that Wallace's line has a role in shaping species distribution and population structure (Barber et al., 2000). Murphy and Austin (2005) also suggested a possible effect of Wallace's line on Macrobrachium rosenbergii, a freshwater prawn, for which strong genetic divergences are observed between the Australian and Thai populations. Therefore, oceanic currents in Southeast Asia could be involved in the isolation of lineages on each side of Wallace's lines like the Indonesian Throughflow current passing in the Makassar Strait (Godfrey, 1996), thus reducing the connectivity between these two subregions. Isolation of the NPO population (Taiwan and China) can also be influenced by a combination of currents present in this area. The presence of the Kuroshio Current (Figure 6), on the western side of the NPO basin, could act as a dispersal barrier and promote lineage diversification or population differentiation, as it has been observed in some marine organisms and the gobioid Periophtalmus modestus (He et al., 2015). Iida et al. (2010) have also shown the important role of the Kuroshio Current to maintain the population structure in the amphidromous goby S. japonicus from Taiwan to northern Japan, thus limiting the range of this species to the islands of the North Pacific. The isolation of the different lineages of M. retzii may have been influenced by these past and current barriers. 1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0 Time (MYA) Considering our results, what is the taxonomic status of these different lineages? Compared to M. brachyurus, mitochondrial MRCA for M. retzii lineages is relatively more ancient and was dated around 1.8 MYA (Figure 5). However, these divergence age estimates should be considered with caution, as the existence of discontinuous gene flow and divergent mitochondrial lineages within the complex may violate the assumptions of the phylogenetic reconstructions of haplotypes presented here (i. e., the lack of genetic structuring). The percentages of divergence between individuals from the three geographical areas are relatively high, ranging from 3.3 % between NPO (China and Taiwan) and WI to 5.1 % between WI and EI (Table 6), with high and significant Φst values (Table 5). These results suggest that the three mitochondrial haplogroups of M. retzii represent closely related species as follow: (i) M. retzii (Bleeker, 1856) (type locality: Manado, Sulawesi, Indonesia) present in Sulawesi, Ceram, Ambon, and in Papua (haplogroup 1) (ii) M. cf. 1 retzii present in WI on the islands of Java, Bali, and Lombok (haplogroup 2), and (iii) M. cf. 2 retzii present in the North Pacific, China, and Taiwan (haplogroup 3). Each of these mitochondrial lineages is therefore restricted to limited geographical areas. These results were expected as endemism is high in this region (Parenti, 2011). Endemism between various close islands of the Indo-Pacific and Indonesia has already been observed (De Mazancourt et al., 2020; Dwiyanto et al., 2021; Haÿ et al., 2021; Jamonneau et al., 2024; Keith et al., 2015; Lord et al., 2012; Wibowo et al., 2023). Indonesian ichthyofauna hosts several radiations of morphologically similar species, and the use of molecular approaches allows us to uncover hidden diversity, including either cryptic or unnamed taxa (Hubert et al., 2015; Kottelat & Lim, 2021; Sholihah et al., 2021 a; Sholihah, Delrieu-Trottin, Sukmono, et al., 2021 b; Utami et al., 2022). The species of this complex are morphologically very similar, but their differentiation, based on genetics and geography, constitutes strong argument in favor of elevating them to the species level. These results warrant a taxonomic revision of M. retzii in Indonesia based on the analysis of nuclear markers, including more specimens and more localities (especially in Borneo, Sulawesi, and the Philippines), and a detailed examination of their morphological characters to revalidate or describe these two potentially new taxa from Java / Bali and from China / Taiwan. This work is in progress.	en	Haÿ, Vincent, Mennesson, Marion I., Carpentier, Camille, Dahruddin, Hadi, Sauri, Sopian, Limmon, Gino, Wowor, Daisy, Hubert, Nicolas, Keith, Philippe, Lord, Clara (2025): Phylogeography of Microphis retzii (Bleeker, 1856) and Microphis brachyurus (Bleeker, 1854) in the Pacific. Journal of Fish Biology 106 (2): 602-620, DOI: 10.1111/jfb.15981, URL: https://doi.org/10.1111/jfb.15981
