identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
627487E1FFDCFFC1E85864ABFF68B1D9.text	627487E1FFDCFFC1E85864ABFF68B1D9.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Haplaxius crudus VanDuzee	<div><p>3.  Results</p><p>3.1. Genome Size, Organization, and Structure. Th e assembled contig demonstrated that the mitochondrial genome of  H. crudus is a circular DNA molecule 15,848bp in length. Th e mitochondrial genome includes 37 genes, 13 PCGs, 22 tRNA genes, and 2 rRNA ribosomal genes (Figure 2, Table 2). Th e new sequence was submitted to GenBank under the accession number (MW057863). Th e major strand (α strand) carries most of the genes (8 PCGs and 14 tRNAs), while the remaining genes are encoded on the minor strand (β strand). Th e AT-rich regions of the mitogenome range from 14,720 to 15,848bp with the location between rrnL and tRNA-Ile (Figure 2). Th e nucleotide composition of the  H. crudus mitochondrial DNA is A � 7,097 (44.8%), T � 5,279 (33.3%), G � 1,341 (8.5%), and C � 2,128 (13.4%) of 15,845 nucleotides present. Th e genome organization generally follows the standard order of the ancestral insect mitochondrial genome plan (Figure 3).</p><p>3.2. Protein-Coding Genes. Th e mitochondrial DNA of  H. crudus contains the full set of PCGs usually present in animal mitochondrial DNA. PCGs are arranged along the genome according to the standard order of insects (Figure 3). Th e putative start codons of PCGs are those previously known for animal mitochondrial DNA, i.e., ATG, ATT, ATA, ATC, GTG, TTG, and GTT (Table 2) [28]. Th e common start codon ATG could be assigned to most of the protein-coding sequences, with few exceptions. Two protein-coding regions, ATP6/ATP8 and ND4/ND4L, overlap and are translated from the same cistronic mRNAs. In addition to the control region, we observed 18 noncodingregionsrangingfrom1to1,210bp(Figure2, Table2). Th e noncoding control region in the  H. crudus mitochondrial genome extends 1,129bp and is located between the final tRNA (tRNA-Val) and the Ile-Gln-Met tRNA cluster. Th ere are many unique TA-dinucleotides and TTA-trinucleotide repeats within the  H. crudus mitochondrialgenomesequencethataresimilarto microsatellite sequence divergence. Th e repeating 21nt motif is AAAATGTCAAAAATTTGGACT 31.</p><p>3.3. Phylogenetic Analysis. Th e phylogenetic analysis performed show that  Haplaxius crudus resolved with  Nilaparvata lugens ( Delphacidae) with strong bootstrap support (100) (Figure 4). Th ere was also strong support (100) for  Aphis aurantii (aphids) resolving near both  H. crudus and  N. lugens . In general, there is strong support (100) for each clade that comprises an order of insect: the  Hemiptera clade that includes  H. crudus,  N. lugens,  A. aurantii,  Dolycoris baccarum, and  Magicicada tredecassini, the  Coleoptera clade that includes  Sitophilus oryzae and  Chauliognathus opacus, the  Odonata clade that includes  Nannophya pygmaea, and the  Diptera clade that includes  Drosophila melanogaster (Figure 4). Based on the pairwise comparison,  N. lugens also shows the highest level of sequence homology among the analyzed taxa, differing from  H. crudus by 28.3% (Table 3).</p><p>All other taxa differ from  H. crudus by at least 30.7% (Table 3).</p></div>	https://treatment.plazi.org/id/627487E1FFDCFFC1E85864ABFF68B1D9	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Komondy, Lidia;Huguet-Tapia, Jose;Ascunce, Marina S.;Helmick, Ericka E.;Goss, Erica M.;Bahder, Brian W.	Komondy, Lidia, Huguet-Tapia, Jose, Ascunce, Marina S., Helmick, Ericka E., Goss, Erica M., Bahder, Brian W. (2021): The Complete Mitochondrial Genome of the American Palm Cixiid, Haplaxius crudus (Hemiptera: Cixiidae). Psyche: A Journal of Entomology (6625462) 2021: 1-8, DOI: 10.1155/2021/6625462, URL: https://doi.org/10.1155/2021/6625462
