taxonID	type	description	language	source
627487E1FFDCFFC1E85864ABFF68B1D9.taxon	description	3.1. Genome Size, Organization, and Structure. Th e assembled contig demonstrated that the mitochondrial genome of H. crudus is a circular DNA molecule 15,848 bp in length. Th e mitochondrial genome includes 37 genes, 13 PCGs, 22 tRNA genes, and 2 rRNA ribosomal genes (Figure 2, Table 2). Th e new sequence was submitted to GenBank under the accession number (MW 057863). Th e major strand (α strand) carries most of the genes (8 PCGs and 14 tRNAs), while the remaining genes are encoded on the minor strand (β strand). Th e AT-rich regions of the mitogenome range from 14,720 to 15,848 bp with the location between rrnL and tRNA-Ile (Figure 2). Th e nucleotide composition of the H. crudus mitochondrial DNA is A � 7,097 (44.8 %), T � 5,279 (33.3 %), G � 1,341 (8.5 %), and C � 2,128 (13.4 %) of 15,845 nucleotides present. Th e genome organization generally follows the standard order of the ancestral insect mitochondrial genome plan (Figure 3). 3.2. Protein-Coding Genes. Th e mitochondrial DNA of H. crudus contains the full set of PCGs usually present in animal mitochondrial DNA. PCGs are arranged along the genome according to the standard order of insects (Figure 3). Th e putative start codons of PCGs are those previously known for animal mitochondrial DNA, i. e., ATG, ATT, ATA, ATC, GTG, TTG, and GTT (Table 2) [28]. Th e common start codon ATG could be assigned to most of the protein-coding sequences, with few exceptions. Two protein-coding regions, ATP 6 / ATP 8 and ND 4 / ND 4 L, overlap and are translated from the same cistronic mRNAs. In addition to the control region, we observed 18 noncodingregionsrangingfrom 1 to 1,210 bp (Figure 2, Table 2). Th e noncoding control region in the H. crudus mitochondrial genome extends 1,129 bp and is located between the final tRNA (tRNA-Val) and the Ile-Gln-Met tRNA cluster. Th ere are many unique TA-dinucleotides and TTA-trinucleotide repeats within the H. crudus mitochondrialgenomesequencethataresimilarto microsatellite sequence divergence. Th e repeating 21 nt motif is AAAATGTCAAAAATTTGGACT 31. 3.3. Phylogenetic Analysis. Th e phylogenetic analysis performed show that Haplaxius crudus resolved with Nilaparvata lugens (Delphacidae) with strong bootstrap support (100) (Figure 4). Th ere was also strong support (100) for Aphis aurantii (aphids) resolving near both H. crudus and N. lugens. In general, there is strong support (100) for each clade that comprises an order of insect: the Hemiptera clade that includes H. crudus, N. lugens, A. aurantii, Dolycoris baccarum, and Magicicada tredecassini, the Coleoptera clade that includes Sitophilus oryzae and Chauliognathus opacus, the Odonata clade that includes Nannophya pygmaea, and the Diptera clade that includes Drosophila melanogaster (Figure 4). Based on the pairwise comparison, N. lugens also shows the highest level of sequence homology among the analyzed taxa, differing from H. crudus by 28.3 % (Table 3). All other taxa differ from H. crudus by at least 30.7 % (Table 3).	en	Komondy, Lidia, Huguet-Tapia, Jose, Ascunce, Marina S., Helmick, Ericka E., Goss, Erica M., Bahder, Brian W. (2021): The Complete Mitochondrial Genome of the American Palm Cixiid, Haplaxius crudus (Hemiptera: Cixiidae). Psyche: A Journal of Entomology (6625462) 2021: 1-8, DOI: 10.1155/2021/6625462, URL: https://doi.org/10.1155/2021/6625462
