identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
D20187A302768C24FF61FF0AFAEBFF29.text	D20187A302768C24FF61FF0AFAEBFF29.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Parnassius smintheus var. niger W. G. Wright 1905	<div><p>Parnassius smintheus var. niger W. G. Wright, 1905 is a junior subjective synonym of Parnassius smintheus smintheus E. Doubleday, 1847 and not of Parnassius smintheus behrii W. H. Edwards, 1870</p><p>Genomic analysis of the holotype of Parnassius smintheus var. niger W. G. Wright, 1905 (type locality USA: California, Sierra Co. Donner Summit, but no locality label on the holotype, sequenced as NVG-22098G08) (Fig. 1 red, highlighted yellow) currently treated as a junior subjective synonym of Parnassius smintheus behrii W. H. Edwards, 1870 (type locality USA: California, Tioga Pass) is not monophyletic with it (Fig. 1 magenta) and is instead in the clade with more eastern subspecies of Parnassius smintheus E. Doubleday, 1847 (type locality in “Rocky Mountains,” possibly Canada: Alberta, vicinity of Rock Lake) (Fig. 1 blue, olive and cyan). While the affinity of P. smintheus var. niger to these eastern subspecies and not to P. s. behrii or northern and western subspecies (P. s. sternitzkyi McDunnough, 1937, P. s. olympianna Burdick, 1941 and P. s. yukonensis Eisner, 1969) is confident, it is more challenging to assign it to one of the eastern taxa using the specimens we sequenced. Tentatively, in accord with the nuclear genome tree (Fig. 1), we place P. smintheus var. niger as a junior subjective synonym of Parnassius smintheus smintheus E. Doubleday, 1847, and hypothesize that its type locality may have been incorrect. Sequencing of additional specimens across the range, including those from around the Donner Pass area in Sierra Co., California, is needed to determine its locality and synonymy more precisely. Our current genomic analysis reveals that Parnassius smintheus maximus Bryk &amp; Eisner, 1937 (type locality in USA: Montana, Fergus Co.) is closely related to the nominotypical P. smintheus (Fig. 1 blue), and it is possible that P. smintheus var. niger is synonymous with the former taxon, or all light on the situation, we avoid replacing the name P. smintheus maximus with P. smintheus niger .</p></div>	https://treatment.plazi.org/id/D20187A302768C24FF61FF0AFAEBFF29	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302758C24FEC5FE8AFB9DFD7F.text	D20187A302758C24FEC5FE8AFB9DFD7F.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Pontia edusa (Fabricius 1777)	<div><p>Pontia edusa (Fabricius, 1777) is confirmed as a species distinct from Pontia daplidice (Linnaeus, 1758)</p><p>Although it cannot be readily identified by external appearance, Pontia edusa (Fabricius, 1777) (type locality in Germany) is most strongly differentiated genetically from Pontia daplidice (Linnaeus, 1758) (type locality in South Europe and Africa), with Fst / Gmin /COI barcode difference of 0.85/0.000/8.2% (54 bp) (Fig. 2). This difference is significantly more than usual for close relatives and is more in line with the difference between species in different subgenera. Therefore, we confirm that Pontia edusa (Fabricius, 1777) is a species distinct from Pontia daplidice (Linnaeus, 1758) . Finally, we note a curious incongruence between the nuclear (Fig. 2a) and mitochondrial (Fig. 2b) genome trees. As expected from their phenotypes, Pontia glauconome (Klug, 1829) (type locality in Egypt) is sister to both P. daplidice and P. edusa in the nuclear genome tree. However, P. edusa gets within the P. glauconome clade in the mitochondrial genome tree, likely due to mitochondrial introgression.</p></div>	https://treatment.plazi.org/id/D20187A302758C24FEC5FE8AFB9DFD7F	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302758C24FE72FB34FEF6FA7A.text	D20187A302758C24FE72FB34FEF6FA7A.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Pontia johnstonii (Crowley 1887)	<div><p>Pontia johnstonii (Crowley, 1887) is a species distinct from Pontia helice (Linnaeus, 1764)</p><p>Synchloe johnstonii Crowley, 1887 (type locality Tanzania: Kilimanjaro) currently treated as a subspecies of Papilio helice Linnaeus, 1764 (type locality South Africa: Tulbagh) in the genus Pontia [Fabricius], 1807 (type species Papilio daplidice Linnaeus, 1758) is genetically differentiated from it at the level characteristic of distinct species (Fig. 2), e.g., COI barcodes differ by 3.8% (25 bp), and is phenotypically distinguished by nearly black framing around olive overscaling of veins on hindwing. Therefore, we propose that Pontia johnstonii (Crowley, 1887), stat. rest. is a species distinct from Pontia helice (Linnaeus, 1764) .</p></div>	https://treatment.plazi.org/id/D20187A302758C24FE72FB34FEF6FA7A	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302758C24FF6CF994FB5EF834.text	D20187A302758C24FF6CF994FB5EF834.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Sinopieris H. Huang 1995	<div><p>Sinopieris H. Huang, 1995 and Artogeia Verity, 1947 are subgenera of Pieris Schrank, 1801</p><p>At times treated as a distinct genus or placed in Pontia [Fabricius], 1807 (type species Papilio daplidice Linnaeus, 1758), Sinopieris H. Huang, 1995 (type species Sinopieris gongaensis H. Huang, 1995) originates within Pieris Schrank, 1801 (type species Papilio brassicae Linnaeus, 1758) according to our genomic trees (Fig. 3). Therefore, Sinopieris belongs to Pieris . However, due to the visual distinction of some of these species resulting in their confusion with Pontia, instead of synonymizing Sinopieris with Pieris, we propose to treat the former as a subgenus of the latter. We note that Pieris extensa Poujade, 1888 (type locality in China) belongs to the subgenus Sinopieris (Fig. 3). Then, to restore the monophyly of the subgenus Pieris, we propose to treat Artogeia Verity, 1947 stat. rev. (type species Papilio napi Linnaeus, 1758), which is sister to Sinopieris (Fig. 3), as another subgenus of Pieris .</p></div>	https://treatment.plazi.org/id/D20187A302758C24FF6CF994FB5EF834	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302748C25FDB4FFD8FD29FB02.text	D20187A302748C25FDB4FFD8FD29FB02.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	(Rapis) Zhang & Cong & Shen & Song & Grishin 2023	<div><p>Rapis Grishin, new subgenus</p><p>http://zoobank.org/ CDE5789D-03D6-4AEF-8974-8F1C57995DD5</p><p>Type species. Papilio rapae Linnaeus, 1758 .</p><p>Definition. Genomic phylogeny of the genus Pieris Schrank, 1801 (type species Papilio brassicae Linnaeus, 1758) reveals several prominent clades that could be regarded as subgenera, including the nominotypical (Fig. 3 violet) and Artogeia Verity, 1947 (type species Papilio napi Linnaeus, 1758) (Fig. 3 blue). Although Sinopieris H. Huang, 1995 (type species Sinopieris gongaensis H. Huang, 1995) (Fig. 3 red) is not supported by a very prominent branch, this group of species is confidently monophyletic, originates around the same time as other subgenera and is phenotypically distinct. The remaining fourth clade (Fig. 3 green) is prominent and cannot be confidently included in other subgenera: it is sister to the subgenus Pieris in the genomic tree, but only with 88% support (not above 95%). Therefore, this green clade represents the fourth subgenus, and it does not have a name. This new subgenus constitutes the P. rapae group of Robbins and Henson (1986), who described and illustrated diagnostic characters for it. In brief, species in the new subgenus are distinguished from the nominotypical subgenus by shorter (less than half the size) and onion-shaped, rather than elongated, androconia and from Artogeia and Sinopieris by the lack of posterior process on signum (Robbins and Henson 1986) and, additionally, by the lack of overscaling along ventral hindwing veins. In DNA, a combination of the following characters is diagnostic in the nuclear genome: pra6360.8.e1:T87A, pra590.15.e1:A181C, pra82.57.e2:G168T, pra82.57. e2:T177C, pra283.114.e1:A531T and in COI barcode: T163A, A205T, T421T, G512G, C533C, T535T, T589C, C641C.</p><p>Etymology. The name is a fusion of the type species name with its genus name: Rap [ae] + [Pier] is. The name is a feminine noun in the nominative singular.</p><p>Species included. The type species (i.e., Papilio rapae Linnaeus, 1758), Papilio canidia Linnaeus, 1768, Pieris krueperi Staudinger, 1860, Pontia mannii J. Mayer, 1851, and Pieris tadjika Grum-Grshimaïlo, 1888 (Robbins and Henson 1986), including their closest relatives sometimes regarded as distinct species.</p><p>Parent taxon. Genus Pieris Schrank, 1801 .</p></div>	https://treatment.plazi.org/id/D20187A302748C25FDB4FFD8FD29FB02	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027B8C2BFF46FF11FB7AFF4E.text	D20187A3027B8C2BFF46FF11FB7AFF4E.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Eugrumia Della Bruna, Gallo, Lucarelli & Sbordoni 2000	<div><p>Eugrumia Della Bruna, Gallo, Lucarelli &amp; Sbordoni, 2000 is a junior subjective synonym of Sinerebia Nakatani, 2017, which is a sister genus of Paralasa Moore, 1893 ( Satyrini: Ypthimina)</p><p>Entirely dark-brown butterfly Erebia atramentaria Bang-Haas, 1927 (type locality China: Gansu Province, Qinling Mountains, Datong River, syntype sequenced as NVG-22126F02) visually similar to a better-known Erebia magdalena Strecker, 1880 (type locality in USA: Colorado, Clear Creek Co.) has been kept in its original genus Erebia Dalman, 1816 (type species Papilio ligea Linnaeus, 1758), the type genus of the subtribe Erebiina Tutt, 1896, since its description until it was designated the type species of Sinerebia Nakatani, 2017, a genus sometimes synonymized with Erebia . Genomic phylogeny places a syntype of Sinerebia atramentaria as a close sister to Eugrumia herse (Grum-Grshimaïlo, 1891) (type locality in China), which is the type species of the genus Eugrumia Della Bruna, Gallo, Lucarelli &amp; Sbordoni, 2000 in the subtribe Ypthimina Reuter, 1896, not Erebiina (Fig. 4 red), with the COI barcode difference of only 0.8–1.2% (5–8 bp), despite the remarkable difference in their wing patterns. Therefore, we confidently propose that Eugrumia syn. nov. is a junior subjective synonym of Sinerebia Nakatani, 2017. Sinerebia is sister to Paralasa Moore, 1893 (type species Erebia kalinda Moore, 1865) (Fig. 4), and some of Sinerebia species were previously included in Paralasa, which is supported by the genetic similarity between the two genera, e.g., COI barcodes of their type species differ by 6.1% (40 bp). This small difference is more characteristic of subgenera than genera. However, pending further studies, we keep Sinerebia and Paralasa as distinct genera due to much closer relationships among species within each genus than between these genera (Fig. 4).</p><p>We suspect that the absence of wing patterns in Sinerebia atramentaria hindered its taxonomic classification until it was revealed by genomic sequencing. Finally, to define the taxonomic identity of this species objectively, N.V.G. hereby designates a syntype in the MTD collection, a male with the following five printed labels, the 4 th yellow, and others white: [Kansu sept.occ. | Hsining | Nanshan mont. | Tatung | 3500m. Juli], [Staudinger | Ankauf 1948], [711], [ atramentaria O. Bang-Haas, 1927 | Grishin] as the lectotype of Erebia atramentaria Bang-Haas, 1927 . The lectotype has noticeable areas on wings with scales partially rubbed off and a small nick by the apex of the left forewing.</p></div>	https://treatment.plazi.org/id/D20187A3027B8C2BFF46FF11FB7AFF4E	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027A8C2BFF5EFEB1FCC0FE7D.text	D20187A3027A8C2BFF5EFEB1FCC0FE7D.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Serradinga G. Henning & S Henning 1996	<div><p>Serradinga G. Henning &amp; S Henning, 1996 is a subgenus of Dingana van Son, 1955</p><p>Genomic sequencing of type species of genera Serradinga G. Henning &amp; S Henning, 1996 ( Leptoneura bowkeri Trimen, 1870) and Dingana van Son, 1955 ( Leptoneura dingana Trimen, 1873) reveals that they are closely related to each other (Fig. 5 red and blue), e.g., their COI barcodes differ by 5.8% (38 bp), which is typical for closely related congeners. Therefore, we propose to treat Serradinga G. Henning &amp; S Henning, 1996 as a subgenus of Dingana van Son, 1955 .</p></div>	https://treatment.plazi.org/id/D20187A3027A8C2BFF5EFEB1FCC0FE7D	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027A8C29FE0CFC2AFCB4FF7B.text	D20187A3027A8C29FE0CFC2AFCB4FF7B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Chlosyne pardelina Zhang & Cong & Shen & Song & Grishin 2023	<div><p>Chlosyne pardelina Grishin, new species</p><p>http://zoobank.org/ 4BB18B88-5D31-42AF-B99C-5B7D74DDCD1F</p><p>(Figs. 6 part, 7)</p><p>Definition and diagnosis. Genomic sequencing of specimens identified as Chlosyne endeis (Godman &amp; Salvin, 1894) (type locality in Mexico: Nayarit) reveals that they are either not monophyletic (in nuclear trees) or prominently separated into two clades (in the mitochondrial genome) (Fig. 6). Fst /COI barcode difference between the specimens in two clades are 0.38/1.5% (10 bp), typical for closely related but distinct species of Chlosyne Butler, 1870 . Therefore, the specimens we sequenced belong to one of the two distinct species. We identify specimens from Nayarit, Mexico, the state with the type locality of C. endeis as that species. Specimens from south Texas (USA) and eastern Mexico are not C. endeis and belong to a different species. This species was at times regarded as a subspecies of C. endeis under the name “pardelina,” which was attributed either to Higgins (Lamas 2004) or to Scott (Pelham 2008). However, neither Higgins (1960) nor Scott (1986) made the name available. Higgins proposed “form pardelina forma nov. ” for “male specimens of endeis …, in which the ground-colour is yellow” (Higgins 1960). However, according to Articles 45.6.1 and 45.6.4.1 of the ICZN Code (ICZN [International Commission on Zoological Nomenclature] 1999), this name is infrasubspecific because it was applied to an infrasubspecific entity and not “adopted” before 1985, and therefore is unavailable. The glossary of the ICZN Code defines “infrasubspecific entity” as “… Specimen(s) within a species differing from other specimens in consequence of intrapopulation variability (e.g., opposite sexes, …,” and Higgins applied the name to male specimens. Scott did not establish this name either because he merely applied it (not even referencing Higgins) to the subspecies of C. endeis “in the U.S. ” without description, definition, or bibliographic reference to such (fails Art. 13.1). Therefore, this species lacks an available name, and is new. This new species is generally similar to C. endeis in having brown wings with yellow or white spots, some in discal bands separated by veins, and two patches of submarginal red spots (sometimes vestigial) distad of the yellow discal band on the dorsal hindwing, by the apex and tornus. The new species differs from C. endeis in having a yellow to orange rather than a white discal band of dorsal hindwing (and frequently on forewing) and typically larger patches of red hindwing spots. Due to phenotypic variability, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: hm2012952-RA.1:A156G, hm2012952-RA.1:A543T, hm2010701-RA.4:C66T, hm2018077-RA.9:G69C, hm2006719-RA.4:C78T and in COI barcode: A286C, C451T, 562T, 574C, A625G. Barcode sequence of the holotype. Sample NVG-17117C06, GenBank OR837724, 658 base pairs: TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGACTTTTAATTCGAACAGAATTAGGAAATCCAGGTTCATTAATTGGAGATGATCAAATTTATAATACA ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTCCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAA TAAATAATATAAGATTTTGATTATTACCCCCCTCATTAATTCTCTTAATTTCCAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGC TCATAGAGGATCTTCTGTTGATTTAGCAATTTTTTCATTACATCTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACTACAATCATTAATATACGAATTAATAATATATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCCCTTTTACTACTTTTATCTTTACCTGTATTAGCTGGAGCTATTACCATACTTCTAACTGATCGAAATATTAATACAT CATTTTTTGATCCTGCAGGGGGAGGAGATCCAATCTTATACCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the Texas A&amp;M University Insect Collection, College Station, TX, USA [TAMU], illustrated in Fig. 7, bears six labels: five white [TEXAS: | DUVAL COUNTY | Texas Hwy 16 ca | 15 mi (24 km) S | of Freer at Parrilla Creek], [ex larva | (had larval diapause) | 11 Sep 1980 | Roy O. Kendall | and C. A. Kendall], [Larval foodplant: | ACANTHACEAE | Carlowrightia | parviflora (Buckl. | Wasshausen (foliage)], [ NYMPHALIDAE: | Chlosyne endeis | pardelina | ♂ Higgins, 1960 | det. Roy O. Kendall | [M. &amp; B. No. 601.b]], [DNA sample ID: | NVG-17117C06 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Chlosyne pardelina | Grishin]. Its pupal case and the last instar caterpillar exuvium are in a gelatine capsule pinned under the specimen. The date given on the label refers to eclosion. Paratypes: 2♀♀: 1♀ the same data as the holotype, but eclosed on 13-Sep-1980 (NVG-17117C05) and 1♀ Mexico: San Luis Potosí, Rte 80, 2–7 mi NW Ciudad del Maíz, 16-Jul-1988, D. Mullins leg. (NVG-19086A10, USNMENT 01314130) [USNM].</p><p>Type locality. USA: Texas, Duval Co., SH 16 ca. 15 mi south of Freer at <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-98.6572&amp;materialsCitation.latitude=27.6478" title="Search Plazi for locations around (long -98.6572/lat 27.6478)">Parrilla Creek</a>, GPS 27.6478, −98.6572 .</p><p>pardelina refers to any small, spotted, or mottled bird, and it fits the general appearance of this species. The name is a feminine noun in apposition.</p><p>Distribution. South Texas and northeastern Mexico.</p></div>	https://treatment.plazi.org/id/D20187A3027A8C29FE0CFC2AFCB4FF7B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302788C29FEB9FE97FA34FCD0.text	D20187A302788C29FEB9FE97FA34FCD0.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Chlosyne anastasia (Hemming 1934)	<div><p>Chlosyne anastasia (Hemming, 1934) is a species distinct from Chlosyne definita (E. Aaron, [1885])</p><p>Melitaea anastasia Hemming, 1934, a replacement name for Melitaea beckeri Godman, [1901] (type locality Mexico: Durango, Durango City), which is a junior primary homonym of Melitaea artemis var. beckeri Herrich-Schäffer, 1851 (type locality in Spain), currently treated as a subspecies of Chlosyne definita (E. Aaron, 1885) (type locality in USA: Texas, Nueces Co.) is genetically distant from it with Fst /COI barcode difference of 0.27/3% (20 bp). The COI barcode difference is large because the mitochondrial DNA of M. anastasia is closest (0.3%, 2 bp between the COI barcodes, likely due to introgression) to Chlosyne endeis (Godman &amp; Salvin, 1894) (type locality in Mexico: Nayarit) (Fig. 6c), a species more distant from M. anastasia according to the nuclear genome tree (Fig. 6a). Because of this genetic differentiation, we propose that Chlosyne anastasia (Hemming, 1934), stat. rest. is a species distinct from Chlosyne definita (E. Aaron, [1885]) . Both C. definita and C. anastasia stat. rest. have been recorded from the state of Durango, where the former is known from the north, and the latter is documented from the south (Fig. 6). Chlosyne anastasia stat. rest. does not occur in the United States.</p></div>	https://treatment.plazi.org/id/D20187A302788C29FEB9FE97FA34FCD0	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302788C2EFE50FC2DFB6FFC4F.text	D20187A302788C2EFE50FC2DFB6FFC4F.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Chlosyne definita subsp. dolosa Zhang & Cong & Shen & Song & Grishin 2023	<div><p>Chlosyne definita dolosa Grishin, new subspecies</p><p>http://zoobank.org/ 0CE8273D-D38A-47D7-A73E-A15A3354B0CC</p><p>(Figs. 6 part, 8)</p><p>Definition and diagnosis. Before this work, western populations of Chlosyne definita (E. Aaron, 1885) (type locality in USA: Texas, Nueces Co.), including those in northwestern Mexican states of Sonora and Chihuahua have been placed within the subspecies Chlosyne definita anastasia (Hemming, 1934) (type locality Mexico: Durango, Durango City) due to their phenotypic similarity in having less extensive dark markings and narrower white band and spots on wings venter. Genomic trees reveal that C. d. anastasia is not monophyletic, and the populations near its type locality are genetically differentiated at the species level (i.e., C. anastasia stat. rest., see above) (Fig. 6), but more northern populations differ from them by 3.3% (22 bp) in COI barcode and are closer related to the nominotypical C. definita (COI barcode difference of 0.6% 4 bp). Therefore, we regard these northwestern Mexico populations as conspecific with C. definita, but due to their phenotypic and genetic differences propose that they constitute a distinct subspecies. This new subspecies is phenotypically more similar to C. anastasia stat. rest. and differs from it in the following characters: the central white band on the ventral hindwing is less broad but broader than in the nominotypical subspecies; black markings are more extensive but less expressed than in the nominotypical subspecies, e.g., the basal white band on the ventral hindwing is typically cut through (or even cut short) by black overscaling around vein 1A+2A. Due to phenotypic variability, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: hm2010867-RA.6:C66T, hm2010867-RA.6:G87A, hm2003966-RA.6:T1521C, hm200 3966-RA.6:C4239T, hm2014195-RA.2:A709G and in COI barcode: A40G, 169T, A205T, T283C, T475T.</p><p>Barcode sequence of the holotype. Sample NVG-22088C12, GenBank OR837725, 658 base pairs: TACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTGGGAACATCTTTAAGACTTTTAATTCGAACAGAATTAGGAAATCCAGGTTCATTAATTGGAGATGATCAAATTTATAATACA ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAA TAAATAATATAAGATTTTGATTATTACCCCCCTCATTAATCCTATTAATTTCCAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGC TCATAGAGGATCATCTGTTGATTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATCACCACAATCATTAATATACGAGTTAATAATATATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCTCTTTTACTACTTTTATCTTTACCTGTATTAGCTGGAGCAATTACAATACTTCTAACTGATCGAAATATTAATACAT CATTCTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 8, bears four printed (text in italics handwritten) labels: three white [Chihuahua, Mex. | 19.4 miles E. of | Tomochic Oak-Pine | July 29, 1984. | ca 7000' Leg D. Mullins], [J. D. Turner ex | Malcolm Douglas | colln. | MGCL Accession | # 2009-26], [DNA sample ID: | NVG-22088C12 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Chlosyne definita | dolosa Grishin]. Paratypes: 2♀♀ Mexico, Sonora, 5 mi NW of Yecora, plateau edge, 25-Jul-1987, M. Smith leg. (NVG-22088D10) and 28/ 29-Jul-1987 (NVG-22088D01) [MGCL].</p><p>Type locality. Mexico: Chihuahua, 19.4 mi E of Tomochic, elevation ca. 7000 '.</p><p>Etymology. In Latin, dolosus means cunning, deceitful, crafty, or sly. The name is given for the deceitful nature of this subspecies, which was hidden behind the name Chlosyne anastasia before it was revealed by genomic sequence comparison. The name is a feminine adjective.</p><p>Distribution. Northwestern Mexico, recorded from the states of Sonora and Chihuahua.</p></div>	https://treatment.plazi.org/id/D20187A302788C2EFE50FC2DFB6FFC4F	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027F8C2FFE98FBAAFCD4FA1B.text	D20187A3027F8C2FFE98FBAAFCD4FA1B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Chlosyne bollii (W. H. Edwards 1878)	<div><p>Chlosyne bollii (W. H. Edwards, 1878) is a species distinct from Chlosyne theona (Ménétriés, 1855)</p><p>Our previous genomic analysis demonstrated that Chlosyne chinatiensis (Tinkham, 1944) (type locality in USA: Texas, Presidio Co.) is a species distinct from Chlosyne theona (Ménétriés, 1855) (type locality in Nicaragua) (Zhang et al. 2020) in agreement with Cassie et al.(2001). Sequencing of additional specimens across the range from Arizona and Texas to Costa Rica reveals that Melitaea bollii W. H. Edwards, 1877 (type locality USA: Texas, Bexar Co., San Antonio), currently regarded as a subspecies of C. theona (Fig. the mitochondrial genome tree (with some possible introgression, Fig. 9c) (i.e., not monophyletic with Chlosyne theona), but is sister to C. theona in the Z chromosome tree (Fig. 9b). All other subspecies of C. theona we sequenced (including a nominotypical specimen from Nicaragua, NVG-22097C09) clustered together and were not strongly separated from each other despite large geographic distances between these populations, e.g., Chlosyne theona thekla (W. H. Edwards, 1870) (type locality in USA: AZ, Pima co.) and Chlosyne theona costaricensis (Austin &amp; M. Smith, 1998) (type locality in Costa Rica), and their phenotypic distinction. The genetic differentiation of C. theona bollii from C. chinatiensis and all other sequenced C. theona subspecies is at the level characteristic of distinct species, i.e., Fst / Gmin /COI barcode difference of 0.62/0.001/0.6% (4 bp, they essentially share mitochondrial DNA) ( C. chinatiensis) and 0.46/0.003/1.2% (8 bp) ( C. theona). Therefore, we propose that Chlosyne bollii (W. H. Edwards, 1878), stat. rest. is a species distinct from Chlosyne theona (Ménétriés, 1855) .</p><p>A natural hybrid between Chlosyne bollii (W. H. Edwards, [1878]) and Chlosyne chinatiensis (Tinkham, 1944)</p><p>Sequencing of a suspected hybrid between Chlosyne bollii (W.</p><p>H. Edwards, [1878]), stat. rest. (type locality USA: Texas,</p><p>Bexar Co., San Antonio) and Chlosyne chinatiensis (Tinkham,</p><p>1944) (type locality in USA: Texas, Presidio Co.), a female</p><p>NVG-19072B01 collected in USA: Texas, Brewster Co., along</p><p>FM2627 25 mi SE of USH385 on 23-Mar-1994 by Steve M .</p><p>Spomer (Fig. 10) places it in different positions in the three trees</p><p>(Fig. 9 olive) thus confirming its hybrid origin. In the nuclear genome tree constructed from autosomes (Fig. 9a), this specimen is sister to C. chinatiensis, suggesting that it has a significant fraction of C. chinatiensis genes. In the Z</p><p>chromosome tree (Fig. 9b), this specimen is within C. bollii,</p><p>suggesting that its Z chromosome, which in females is inherited from the father (in butterflies, ZZ are males and ZW are females), came from C. bollii . In the mitochondrial genome tree</p><p>(Fig. 9c), the specimen is placed within C. chinatiensis,</p><p>suggesting that its mitochondrial DNA, which is inherited from the mother, came from C. chinatiensis . Therefore, we confirm this female as a natural interspecies hybrid and conclude that its father was C. bollii, and its mother was C. chinatiensis .</p></div>	https://treatment.plazi.org/id/D20187A3027F8C2FFE98FBAAFCD4FA1B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027E8C2FFEFDF985FEAFF82B.text	D20187A3027E8C2FFEFDF985FEAFF82B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Euselasia satyroides Lathy 1926	<div><p>Euselasia satyroides Lathy, 1926 and Eurygona modesta H. Bates, 1868 belong to the genus Eugelasia Grishin, 2021</p><p>Genomic trees reveal that Euselasia satyroides Lathy, 1926 (type locality in Argentina) is sister to Eugelasia brevicauda (Lathy, 1926) (type locality in Bolivia) and, therefore, originates within the genus Eugelasia Grishin, 2021 (type species Eurygona eugeon Hewitson, 1856) (Fig. 11). Although we have not sequenced Eurygona modesta H. Bates, 1868, currently in the genus Euselasia Hübner, 1819 (type species Euselasia gelaena Hübner, 1819, which is a junior subjective synonym of Papilio gelon Stoll, 1787), it is phenotypically similar to E. satyroides and its relatives (Santos et al. 2014). Therefore, we propose the following new combinations: Eugelasia satyroides (Lathy, 1926) and Eugelasia modesta (H. Bates, 1868) .</p></div>	https://treatment.plazi.org/id/D20187A3027E8C2FFEFDF985FEAFF82B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027D8C2CFF4DFD93FD0CFC9A.text	D20187A3027D8C2CFF4DFD93FD0CFC9A.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Eurygona leucophryna Schaus 1913	<div><p>Eurygona leucophryna Schaus, 1913 belongs to the genus Pelolasia Grishin, 2021</p><p>Genomic sequencing of a syntype of Eurygona leucophryna Schaus, 1913 (type locality in Costa Rica: Cachí) reveals that it is sister to Pelolasia cataleuca (R. Felder, 1869) (Fig. 11) in the genus Pelolasia Grishin, 2021 (type species Eurygona pelor Hewitson, 1853). This close relationship with P. cataleuca was mentioned in the original description of E. leucophryna (Schaus 1913) . Thus, we propose Pelolasia leucophryna (Schaus, 1913), comb. nov.</p></div>	https://treatment.plazi.org/id/D20187A3027D8C2CFF4DFD93FD0CFC9A	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027D8C2DFE08FCE8FB29FB32.text	D20187A3027D8C2DFE08FCE8FB29FB32.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Erythia paracheles Zhang & Cong & Shen & Song & Grishin 2023	<div><p>Erythia paracheles Grishin, new species</p><p>http://zoobank.org/ E7E4D9E8-760B-4D0F-BFC7-DD0060AC7FBB (Figs. 12, 13 part)</p><p>Definition and diagnosis. Genomic analysis reveals that an orange female from central Panama (Figs. 12, 13 orange) initially identified as an aberration of Erythia aurantiaca (Salvin &amp; Godman, 1868) (type locality in Guatemala) is instead sister to but genetically differentiated from Erythia cheles (Godman &amp; Salvin, 1889) (type locality in Panama: Chiriquí, holotype sequenced as NVG-21123B03) (Fig. 13), e.g., COI barcode difference of 4.4% (29 bp). We sequenced two specimens of E. cheles (the holotype and another female, NVG-19036F06), and they are genetically close to each other (Fig. 13 blue). However, due to strong genetic differentiation, the orange female represents a distinct species that, according to our investigation, does not have a name. The female of this new species differs from its relatives in the nearly uniform orange coloration of the dorsal side of wings, only with a hint of the brown outer margin, more developed by the apex of the forewing, and is similarly orange, only slightly yellower, on the ventral side, with a thin postdiscal darker orange band on both wings and no other markings. In females of other species, the apex of the dorsal forewing and usually the outer margin are largely brown, and there are at least traces of black submarginal spots on the ventral hindwing. While it remains unclear whether this specimen is an aberration, we are confident that it is a species distinct from both E. cheles and E. aurantiaca due to its prominent genetic differentiation, and, therefore, it is described as a new species. To confidently identify this new species despite the unknown phenotypic variation, we provide a diagnostic combination of DNA characters in the nuclear genome: cne11073.6.7: T54 C, cne3970.3.2: T111 C, cne20880. 1.4:A84G, cne10214.9.8:A66G, cne4577.3.8:C18T, cne 1935.4.1:C1113C (not T), cne 1935.4.1:C1558C (not A), cne84.2.2:C1860C (not T), cne15258.2.1:A612A (not T), cne14561.1.14:C79C (not T) and in the COI barcode: T16 C, 88C, T142 C, T169 C, T250 C, T361 C, T391 A, T400 C, A577G, T619 C.</p><p>Barcode sequence of the holotype. Sample NVG-19036F07, GenBank OR837726, 658 base pairs: AACTTTATATTTTATCTTTGGAATTTGAGCAGGAATAGTAGGAACATCATTAAGACTATTAATTCGAATAGAATTAGGAATTTCAGGCTCTTTTATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCCATTATAATCGGAGGATTTGGAAATTGACTAGTCCCCCTAATATTAGGAGCCCCTGATATAGCTTTTCCACGAA TAAATAACATAAGATTTTGATTATTACCCCCCTCATTAATACTTTTAATTTCAAGAAGAATTGTCGAAAACGGAGCAGGAACAGGATGAACTGTGTACCCCCCACTATCATCTAATATCGC TCACAGAGGATCATCAGTTGATTTAGCAATTTTTTCCTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAACTTTATCACAACAATTATTAATATACGAGTAAATAATATAATA TTCGATCAAATATCCCTATTTATCTGAGCTGTTGGTATTACAGCTCTATTACTTTTACTATCATTACCAGTTTTAGCAGGAGCTATTACTATGCTATTAACTGATCGAAATTTAAATACAT CATTTTTTGATCCCGCTGGAGGAGGAGATCCAATTCTTTACCAACATTTATTT</p><p>Type material. Holotype: ♀ deposited in the National Museum of Natural History, Washington, DC, USA [USNM], illustrated in Fig. 12, bears four printed labels: three white [ Riodinidae ? 3/28/76 | Las Cruces Trail, CZ], [DNA sample ID: | NVG-19036F07| c/o Nick V. Grishin], [USNMENT | {QR Code} | 00939912], and one red [HOLOTYPE ♀ | Erythia paracheles | Grishin].</p><p>Type locality. Panama: Canal Zone, Las Cruces Trail .</p><p>Etymology. The prefix “para” means alongside, near, beyond, or similar to. This new species is sister to E. cheles and is similar to it. The name is treated as a masculine noun in apposition.</p><p>Distribution. Currently known only from the holotype collected in central Panama.</p></div>	https://treatment.plazi.org/id/D20187A3027D8C2DFE08FCE8FB29FB32	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027C8C32FDF0FB4FFB29F998.text	D20187A3027C8C32FDF0FB4FFB29F998.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Erythia borrosa Zhang & Cong & Shen & Song & Grishin 2023	<div><p>Erythia borrosa Grishin, new species</p><p>http://zoobank.org/ 86B396F7-EF80-4EC8-AE29-A4D674DCDDDF</p><p>(Figs. 13 part, 14)</p><p>Definition and diagnosis. Genomic phylogeny inferred from all sequenced specimens of Euselasiini Kirby, 1871 (1867) reveals that a specimen from central Panama (Figs. 13 magenta, 14) is sister to the clade of Erythia cheles (Godman &amp; Salvin, 1889) (type locality in Panama: Chiriquí) with Erythia paracheles sp. n. (type locality in Panama: Canal Zone) and therefore represents a species distinct from them (Fig. 13), also being strongly differentiated genetically, e.g., COI barcode difference of 4.9% (32 bp) from E. cheles and 5.9% (39 bp) from E. paracheles . These three species form a clade sister to Erythia aurantiaca (Salvin &amp; Godman, 1868) (type locality in Guatemala). Even in wing patterns, the specimen from Panama appears different from the named taxa, and these differences, supported by genetic differentiation, suggest that this specimen belongs to a new species. Males of this new species differ from their relatives in a diffuse boundary between brown framing along wing margins and orange interior on the dorsal side: brown overscaling partially extends into orange areas. The brown/orange boundary is sharper and could even be rather crips in closely related species, or orange areas are more restricted on forewing to the area between the inner margin and discal cell. The costal area of the dorsal hindwing is brown from its base, and the discal cell is largely orange but brown towards the costa; the dorsal hindwing has a brown batch at the apex and a brown margin of decreasing width and disappearing towards the tornus; the submarginal area is browner than the brighter orange discal area from costa to mid-wing. The ventral side of the wings is pearly-pinkish with a posdiscal pale-brown line on all wings (close to a submarginal row of spots on the hindwing) and orange-brown narrow marginal framing. Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne5785.3.5:A96T, cne7688.1.2:T150G, cne3970. 3.2:G96A, cne254625.2.3:G270A, cne10780.4.1:T1347A, cne4782.4.3:T282T (not C), cne3195.11.14:A54A (not G), cne563.4.3:G216G (not A), cne563.4.3:G219G (not A), cne3970.3.2:T111T (not C) and in COI barcode: T4C, T56T, T197T, T202C, T206T, T274C, T550C.</p><p>Barcode sequence of the holotype. Sample NVG-19036H09, GenBank OR837727, 658 base pairs: AACCTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAATAGAACTAGGAATTTCAGATTCTTTTATTGGAGATGATCAAATTTATAACACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCATTAATATTAGGAGCCCCTGATATAGCTTTTCCACGAA TAAATAATATAAGATTTTGATTATTACCCCCCTCATTAATTCTCTTAATTTCAAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACTGTGTACCCCCCACTATCATCTAATATTGC TCATAGAGGATCATCAGTTGATTTAGCTATTTTCTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAGTAAATAATATAATA TTTGATCAAATATCTCTATTTATTTGAGCTGTAGGAATTACAGCATTATTACTCTTATTATCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATCTAAATACAT CATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTCTTTATCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the National Museum of Natural History, Washington, DC, USA [USNM], illustrated in Fig. 14, bears four printed (2 nd and 3 rd lines on the 1 st label handwritten) labels: three white [Panama: Panama | Cerro Campana | 800m. 17.III.1973 | G. B. Small], [DNA sample ID: | NVG-19036H09 | c/o Nick V. Grishin], [USNMENT | {QR Code} | 01544858], and one red [HOLOTYPE ♂ | Erythia borrosa | Grishin].</p><p>Type locality. Panama: Panama Province, Cerro Campana, elevation 800 m.</p><p>Etymology. In Spanish, borrosa means blurry or fuzzy. The name refers to edges between brown and orange in this species that lack the sharpness of its relatives, and brown gradually dissolves into orange, or orange is overscaled with brown towards the margins. The name is a Latinized feminine adjective.</p><p>Distribution. Currently known only from the holotype collected in central Panama.</p></div>	https://treatment.plazi.org/id/D20187A3027C8C32FDF0FB4FFB29F998	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302638C33FEDDF9F5FC9FFF4E.text	D20187A302638C33FEDDF9F5FC9FFF4E.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Mesosemia nesti Hewitson 1858	<div><p>Mesosemia nesti Hewitson, 1858, Mesosemia acuta Hewitson, 1873, and Mesosemia eurythmia Stichel, 1915 belong to the genus Ectosemia Grishin, 2021</p><p>Genomic sequencing of Mesosemia nesti Hewitson, 1858 (type locality in French Guiana)—the species transferred to Semomesia Westwood, 1851 (type species Papilio croesus Fabricius, 1777) in Callaghan and Lamas (2004) —and Mesosemia acuta Hewitson, 1873 (type locality in Brazil, possibly Rio de Janeiro) reveals that they are not monophyletic with Mesosemia Hübner, 1819 (type species Mesosemia philoclessa Hübner, 1819) that includes Semomesia as its junior subjective synonym, but instead originate within the genus Ectosemia Grishin, 2021 (type species Papilio eumene Cramer, 1776) (Fig. 15). Therefore, we propose the following new combinations: Ectosemia nesti (Hewitson, 1858) and (type locality in Brazil: Amazonas), we tentatively place it in Ectosemia due to wing pattern similarities: Ectosemia eurythmia (Stichel, 1915), comb. nov.</p></div>	https://treatment.plazi.org/id/D20187A302638C33FEDDF9F5FC9FFF4E	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302628C30FED9F900FD68FF29.text	D20187A302628C30FED9F900FD68FF29.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Mesosemia eumene subsp. attavus J. Zikan 1952	<div><p>Mesosemia eumene race attavus J. Zikán, 1952 is a species distinct from Ectosemia eumene (Cramer, 1776)</p><p>The genomic comparison reveals that Mesosemia eumene race attavus J. Zikán, 1952 (type locality in Brazil: Amazonas, São Gabriel da Cachoeira municipality, Rio Negro), currently a subspecies of Ectosemia eumene (Cramer, 1776) (type locality in Suriname), is strongly differentiated genetically from the latter (Fig. 15), e.g., COI barcode difference of 4.4% (29 bp). These genetic and also pronounced phenotypic differences in wing patterns (narrower dark brown dorsal hindwing bands) and shapes (more distinct from Ectosemia eumene (Cramer, 1776) .</p></div>	https://treatment.plazi.org/id/D20187A302628C30FED9F900FD68FF29	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302628C33FEF0FD14FB40F9E7.text	D20187A302628C33FEF0FD14FB40F9E7.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Mesosemia eumene subsp. furia Stichel 1910	<div><p>Mesosemia eumene furia Stichel, 1910 is a junior subjective synonym of Ectosemia erinnya (Stichel, 1910)</p><p>Genomic analysis of syntypes of Mesosemia eumene erinnya Stichel, 1910 (type locality in Ecuador and Peru, sequenced as NVG-21126B12 and NVG-21126C01), currently a valid species of Ectosemia Grishin, 2021 (type species Papilio eumene Cramer, 1776) and Mesosemia eumene furia Stichel, 1910 (type locality in Bolivia and Peru, sequenced as NVG-21126B11) kept in the same status since its description and, as a consequence of being a subspecies of the type species (Zhang et al. 2021) of Ectosemia, transferred in this genus, reveals that they are genetically close (Fig. 15), do not segregate into separate clades, and most likely are conspecific. Therefore, we propose that Mesosemia eumene furia Stichel, 1910, syn. nov. is a junior subjective synonym of Ectosemia erinnya (Stichel, 1910) . To define these taxa objectively and to clarify their type localities, their lectotypes are designated below.</p><p>First, N.V.G. hereby designates a syntype in the MFNB collection, a female with the following six printed (but 4 th handwritten) labels, the 1 st red, 4 th greenish-gray, and others white: [Typus], [Süd Peru | Pozuzo | e.c.H.Stichel], [2266], [erinnya | Stich.], [ex coll. | H. STICHEL], and [DNA sample ID: | NVG-21126B12 | c/o Nick V. Grishin] as the lectotype of Mesosemia eumene erinnya Stichel, 1910 . The lectotype is a specimen in good condition with half of its right antenna broken off, and some scales rubbed off near the middle of the forewing outer margin. The type locality of Ectosemia erinnya becomes Peru: Pozuzo. According to our genomic analysis, the lectotype is conspecific with the paralectotype (NVG-21126C01) from Ecuador: Archidona (Fig. 15).</p><p>Second, N.V.G. hereby designates a syntype in the MFNB collection, a male with the following six printed (but 4 th handwritten) labels, the 1 st red, 4 th greenish-gray, and others white: [Typus], [Bolivia La Paz | Farinas | e.c.H.Stichel], [2265], [furia | Stich.], [ex coll. | H. STICHEL], and [DNA sample ID: | NVG-21126B11 | c/o Nick V. Grishin] as the lectotype of Mesosemia eumene furia Stichel, 1910 . The lectotype lacks the abdomen, and outer-marginal segments of the right forewing are chipped off from the middle to the tornus. The type locality of M. e. furia becomes Bolivia: La Paz, Farinas.</p></div>	https://treatment.plazi.org/id/D20187A302628C33FEF0FD14FB40F9E7	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302618C31FDFEFF7FFBC3FCD4.text	D20187A302618C31FDFEFF7FFBC3FCD4.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cremna telarania Zhang & Cong & Shen & Song & Grishin 2023	<div><p>Cremna telarania Grishin, new species</p><p>http://zoobank.org/ 8EF9AA2F-9A47-4201-9E26-C1507FDC9FD0 (Figs. 16, 17 part)</p><p>Definition and diagnosis. Genomic sequencing of Cremna E. Doubleday, 1847 (type species Papilio actoris Cramer, 1776) reveals a clade consisting of a pair from Bolivia (Fig. 16) distinct from other species in the C. actoris group (Fig. 17): COI barcode difference of 1.8% (12 bp) with a syntype of Cremna meleagris Hopffer, 1874 (type locality in Peru: Chanchamayo), a junior subjective synonym of Cremna heteroea H. Bates, 1867 (type locality in Brazil: Amazonas), sister to the clade representing the new species. This new species differs from its relatives in smaller size, paler wings (especially beneath), more prominent cream-colored marginal spots above, and boomerang-shaped, narrower on the dorsal side postdiscal (in addition to submarginal) spots on both wings (weak on dorsal forewing in the female). These spots are broader and rounder in other species and are crescent-shaped only in Cremna calitra Hewitson, 1869 (type locality in Ecuador), a species with mostly larger spots on the dorsal side, but smaller spots along the outer wing margins (especially on the hindwing) and on the ventral side.</p><p>Barcode sequence of the holotype. Sample NVG-22112E04, GenBank OR939283, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGTTCATCTTTAAGTATTTTAATTCGTATAGAATTAGGAATACCTGGTTCTCTTATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATCGGAGGATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCACGTA TAAATAATATAAGTTTTTGACTTTTACCCCCCTCTTTATTCCTTTTAATTTCGAGAAGAATTGTCGAAAATGGAGCAGGTACAGGATGAACTGTCTACCCCCCTTTATCTTCTAATATTGC TCACAGAGGCTCTTCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCCGGTATTTCTTCTATTTTAGGTGCTATTAATTTCATTACAACTATTATCAATATACGTATTAATAATTTATCA TTTGATCAAATACCTTTATTTGTTTGATCAGTTGGTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAACTTAAATACTT CTTTTTTCGACCCAGCAGGAGGAGGAGACCCTATTCTTTATCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany [MFNB], illustrated in Fig. 16a, bears five rectangular labels, the first two handwritten and others printed: four white [Bolivia | Torochita | 90. Garl.], [meleagris | Hopff.], [Coll. | Satudinger], [DNA sample ID: | NVG-22112E04 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Cremna telarania | Grishin]. Paratype: 1♀ with the same data as the holotype (NVG-22112E11, GenBank barcode OR939284, Fig. 16b).</p><p>Type locality. Bolivia: La Paz Department, Mapiri .</p><p>Etymology. In Spanish, la telaraña means spider web. The name is given for the cobweb wing pattern of this species. The name is a feminine noun in apposition.</p><p>Distribution. Currently known only from the La Paz Department in Bolivia.</p></div>	https://treatment.plazi.org/id/D20187A302618C31FDFEFF7FFBC3FCD4	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302608C31FE5BFC31FE43FB72.text	D20187A302608C31FE5BFC31FE43FB72.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cremna dentata (Stichel 1910) Zhang & Cong & Shen & Song & Grishin 2023	<div><p>Cremna dentata (Stichel, 1910) is a species distinct from Cremna radiata (Godman &amp; Salvin, 1886)</p><p>Genomic analysis reveals that Voltinia radiata dentata Stichel, 1910 (type locality in Colombia), currently treated as a junior subjective synonym of Cremna radiata (Godman &amp; Salvin, 1886) (type locality Costa Rica: Irazú), is genetically differentiated from it at the level characteristic of distinct species (Fig. 18), e.g., COI barcode difference of 2.6% (17 bp) in the presence of phenotypic distinction (Lukhtanov et al. 2016): C. dentata typically has longer white rays between veins on wings. Therefore, we propose that Cremna dentata (Stichel, 1910), stat. nov. is a species distinct from Cremna radiata (Godman &amp; Salvin, 1886) .</p></div>	https://treatment.plazi.org/id/D20187A302608C31FE5BFC31FE43FB72	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302608C34FE5AF9CAFCA1FDDF.text	D20187A302608C34FE5AF9CAFCA1FDDF.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cremna pupillata (Stichel 1910) Stichel 1915	<div><p>Cremna pupillata Stichel, 1915 is a species distinct from Cremna alector (Geyer, 1837)</p><p>Genomic analysis reveals that specimens identified as Cremna alector (Geyer, 1837) (type locality in Brazil) partition into two genetically differentiated clades suggestive of species level (Fig. 19): e.g., their COI barcodes differ by 3.6% (24 bp). Upon phenotypic inspection, we find that specimens in one clade have white spots by forewing costa in the postdiscal blue band, and specimens in the other clade lack them, among other differences discussed by Hall (2005). While syntypes of C. alector are likely lost, original illustrations of this species show the lack of spots (Geyer 1837). Inspecting these illustrations, we alector pupillata Stichel, 1910 (type locality in Brazil: Espírito Santo, sequenced as NVG-21125A10) has the spots and thus, according to our genomic results, is a species different from C. alector, represented by two specimens without spots from Linhares, Espírito Santo in Brazil (Fig. 19). Therefore, we propose that Cremna pupillata Stichel, 1915, stat. nov. is a species distinct from Cremna alector (Geyer, 1837) .</p><p>A species list of Napaeina J. Hall, 2003 assigned to genera</p><p>The list below is mostly based on previously published results (Callaghan and Lamas 2004; Hall 2005; Seraphim et al. 2018; Zhang et al. 2021) guided by the genome-level phylogeny (Fig. 20) and is given to correct some ambiguities and mistakes. For example, Zhang et al. (2021) gave an erroneous combination Napaea sanarita (Schaus, 1902) (type locality in Brazil: Rio de Janeiro) while correctly resurrecting the genus Eucorna Strand, 1932 of which Eucora sanarita Schaus, 1902 is the type and the only species</p><p>Cremna E. Doubleday, 1847 (type species Papilio actoris Cramer, 1776), not Napaea Hübner, 1819 (type species Cremna eucharila Bates, 1867) (Fig. 20).</p><p>Assignment of species to genera follows our study (Zhang et al. 2021), and we attempt arranging species in the list to maximize the phenotypic similarity of the neighbors but without disrupting a phylogenetic order given by genomic trees (Fig. 20): i.e., a strongly supported clade in the trees is a continuous segment in the list. We start with Hyphilaria, but the order of the entire list can be reversed. We put Cremna and Napaea next to each other because species in these genera are similar (Hall 2005). To maintain phylogenetic order, the considerations above necessitate placing Ithomiola last. Finally, we situate Eucorna next to Cremna instead of it being last in the list because Eucorna looks more different from Ithomiola than from Cremna . Similar arguments were applied within each genus. Further suggestions about the order to optimize similarity in appearance between neighbors are encouraged.</p><p>Only valid names of genera and species are given below; for subspecies, see the Butterflies of America website (Warren et al. 2023); for synonyms and taxonomic discussions, see other publications (Callaghan and Lamas 2004; Hall 2005). Type genus (for family-group names) or type species (for genusgroup names) names are given in parenthesis, and names of type species are underlined.</p><p>Tribe Mesosemiini Grote, 1898 ( Mesosemia Hübner, [1819]) Subtribe Napaeina J. Hall, 2003 ( Napaea Hübner, [1819])</p><p>Genus Hyphilaria Hübner, [1819] ( Hyphilaria nicia Hübner, [1819])</p><p>Hyphilaria anthias (Hewitson, 1874)</p><p>Hyphilaria nicia Hübner, [1819]</p><p>Hyphilaria parthenis (Westwood, 1851)</p><p>Genus Eucorna Strand, 1932 ( Eucora sanarita Schaus, 1902)</p><p>Eucorna sanarita (Schaus, 1902)</p><p>Genus Cremna E. Doubleday, 1847 ( Papilio actoris Cramer, 1776)</p><p>Cremna alector (Geyer, 1837)</p><p>Cremna pupillata Stichel, 1915, stat. nov.</p><p>Cremna radiata (Godman &amp; Salvin, 1886)</p><p>Cremna dentata (Stichel, 1910), stat. nov.</p><p>Cremna theata (Stichel, 1910)</p><p>Cremna actoris (Cramer, 1776)</p><p>Cremna heteroea H. Bates, 1867</p><p>Cremna telarania Grishin, sp. n.</p><p>Cremna calitra Hewitson, 1869</p><p>Genus Napaea Hübner, [1819] ( Cremna eucharila Bates, 1867)</p><p>Napaea sylva (Möschler, 1877)</p><p>Napaea beltiana (H. Bates, 1867)</p><p>Napaea dramba (J. Hall, Robbins &amp; Harvey, 2004) [fossil]</p><p>Napaea danforthi A. Warren &amp; Opler, 1999</p><p>Napaea umbra (Boisduval, 1870)</p><p>Napaea loxicha (RG. Maza &amp; J. Maza, 2016)</p><p>Napaea maya (J. Maza &amp; Lamas, 2016)</p><p>Napaea necaxa (RG. Maza &amp; J. Maza, 2018)</p><p>Napaea totonaca (RG. Maza &amp; J. Maza, 2016)</p><p>Napaea rufolimba J. Hall, 2005</p><p>Napaea tumbesia J. Hall &amp; Lamas, 2001</p><p>Napaea fratelloi J. Hall &amp; Harvey, 2005</p><p>Napaea eucharila (H. Bates, 1867)</p><p>Napaea frustatoria Brévignon, 2019</p><p>Napaea phryxe (C. Felder &amp; R. Felder, 1865)</p><p>Napaea agroeca Stichel, 1910</p><p>Napaea cebrenia (Hewitson, [1873])</p><p>Napaea zikani Stichel, 1923</p><p>Napaea elisae (J. Zikán, 1952)</p><p>Napaea joinvilea J. Hall &amp; Harvey, 2005</p><p>Napaea melampia (H. Bates, 1867)</p><p>Napaea mellosa J. Hall &amp; Harvey, 2005</p><p>Napaea gynaecomorpha J. Hall, Harvey &amp; Gallard, 2005</p><p>Napaea merula (Thieme, 1907)</p><p>Genus “new genus 1” Seraphim et al. 2018</p><p>“ Napaea ” thasus (Stoll, 1780) comb. nov. [placed in its possible sister genus for now just to have a genus name] Genus Ithomiola C. Felder &amp; R. Felder, 1865 ( Ithomiola floralis C. Felder &amp; R. Felder, 1865)</p><p>Ithomiola eburna (J. Hall &amp; Harvey, 2005)</p><p>Ithomiola candidata (Hewitson, 1874)</p><p>Ithomiola oweni (Schaus, 1913)</p><p>Ithomiola calculosa J. Hall &amp; Harvey, 2005</p><p>Ithomiola theages (Godman &amp; Salvin, 1878)</p><p>Ithomiola cribralis (Stichel, 1915)</p><p>Ithomiola neildi (J. Hall &amp; Willmott, 1998)</p><p>Ithomiola bajotanos J. Hall, 2005</p><p>Ithomiola tanos (Stichel, 1910)</p><p>Ithomiola nepos (Fabricius, 1793)</p><p>Ithomiola orpheus (Westwood, 1851)</p><p>Ithomiola callixena (Hewitson, 1870)</p><p>Ithomiola buckleyi J. Hall &amp; Willmott, 1998</p><p>Ithomiola floralis C. Felder &amp; R. Felder, 1865</p></div>	https://treatment.plazi.org/id/D20187A302608C34FE5AF9CAFCA1FDDF	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302658C35FE6DFD0EFE64FDD9.text	D20187A302658C35FE6DFD0EFE64FDD9.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Lasaia peninsularis (Clench 1972) Clench 1972	<div><p>Lasaia peninsularis Clench, 1972 is a species distinct from Lasaia sula Staudinger, 1888</p><p>Genomic analysis reveals that Lasaia sula peninsularis Clench, 1972 (type locality Mexico: Yucatán, Pisté) is genetically differentiated from Lasaia sula Staudinger, 1888 (type locality in Honduras) at the level characteristic of distinct species (Fig. 21) with Fst / Gmin /COI barcode difference of 0.52/0.005/1.5% (10 bp), with the barcode difference computed between lectotypes of both names. Therefore, we propose that Lasaia peninsularis Clench, 1972, stat. nov. is a species distinct from Lasaia sula Staudinger, 1888 .</p><p>Although traditionally treated as distinct (and monophyletic) genera for more than 170 years, Lyropteryx Westwood, 1851 (type species Lyropteryx apollonia Westwood, 1851) and Necyria Westwood, 1851 (type species Necyria bellona Westwood, 1851) are genetically (Fig. 21) and phenotypically close. COI barcodes of their type species differ by 2.7% (18 bp), which is typical for closely related sister species, not different genera, and both genera are characterized by lyre- or harp-like wing patterns resulting from metallic overscaling between the veins complemented with red spots or stripes. A novice cannot easily assign a species to a genus by wing patterns. For all these reasons, we propose to treat these monophyletic groups as subgenera. Necyria and Lyropteryx were proposed in the same work issued on the same day (Westwood 1851), and being the first revisers, we give precedence to Lyropteryx because this name is more descriptive of a butterfly appearance: its wing (πτέρυξ - pteryx) resembles the musical instrument lyre (λύρα - lyra). Therefore, we propose that Necyria Westwood, 1851, stat. nov. is a subgenus of Lyropteryx Westwood, 1851 .</p></div>	https://treatment.plazi.org/id/D20187A302658C35FE6DFD0EFE64FDD9	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302648C35FF74FBAFFB39FA5F.text	D20187A302648C35FF74FBAFFB39FA5F.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Eurygona pulcherrima Herrich-Schaffer 1853	<div><p>Eurygona? pulcherrima Herrich-Schäffer, [1853] and Themone poecila H. Bates, 1868 belong to the genus Isapis E. Doubleday, 1847 and not Themone Westwood, 1851</p><p>Eurygona? pulcherrima Herrich-Schäffer, [1853] (type species in Suriname) and Themone poecila H. Bates, 1868 (type locality Brazil: Amazonas, Ega [= Tefé]) currently placed in the genus Themone Westwood, 1851 (type species Helicopis pais Hübner, [1820]) are not monophyletic with it and instead form a clade together with Isapis E. Doubleday, 1847 (type species Papilio agyrtus Cramer, 1777) and are close to it genetically (Fig. 21). To restore monophyly of Themone, we transfer the two species to Isapis forming new combinations Isapis pulcherrima (Herrich-Schäffer, [1853]), comb. nov. and Isapis poecila (H. Bates, 1868), comb. nov. Furthermore, we note that the clade with these species is sister to Melanis Hübner, [1819] (type species Papilio melander Stoll, 1780), and they are closely related to it, i.e., COI barcodes of the type species of Melanis and Isapis differ by 7.3% (48 bp). Therefore, Isapis can be included in Melanis, a step we are not taking here but proposing for consideration.</p></div>	https://treatment.plazi.org/id/D20187A302648C35FF74FBAFFB39FA5F	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302648C35FF44FD34FA9DFC52.text	D20187A302648C35FF44FD34FA9DFC52.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Lymnas melaniae Stichel 1930	<div><p>Lymnas melaniae Stichel, 1930 belongs to the genus Lyropteryx Westwood, 1851 and not Melanis Hübner, [1819]</p><p>Genomic phylogeny reveals that Lymnas melaniae Stichel, 1930 (type locality in Brazil: Santa Catarina), currently in the genus Melanis Hübner, [1819] (type species Papilio melander Stoll, 1780), is not monophyletic with it and instead is a close sister to Lyropteryx Westwood, 1851 (type species Lyropteryx apollonia Westwood, 1851) (Fig. 21): COI barcode difference of 2.3% (15 bp), which is typical for closely related congeners. To restore the monophyly of Melanis, we transfer L. melaniae to the genus Lyropteryx, forming a new combination Lyropteryx melaniae (Stichel, 1930), comb. nov.</p></div>	https://treatment.plazi.org/id/D20187A302648C35FF44FD34FA9DFC52	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302648C3AFDCCF9BAFD62FE59.text	D20187A302648C3AFDCCF9BAFD62FE59.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	(Callitera) Zhang & Cong & Shen & Song & Grishin 2023	<div><p>Callitera Grishin, new subgenus</p><p>http://zoobank.org/ 261B10A3-E22E-49EA-97B3-466C4393884E</p><p>Type species. Eurygona? pulcherrima Herrich-Schäffer, [1853] .</p><p>Definition. As shown above, Eurygona? pulcherrima Herrich-Schäffer, [1853] (type locality in Suriname) belongs to the genus Isapis E. Doubleday, 1847 (type species Papilio agyrtus Cramer, 1777) and not to Themone Westwood, 1851 (type species Helicopis pais Hübner, [1820]) (Fig. 21). However, it is genetically differentiated from the type species of Isapis at the subgenus level, e.g., their COI barcodes differ by 6.5% (43 bp). Therefore, we propose that the lineage with Isapis pulcherrima represents a new subgenus. This subgenus differs from its relatives by a combination of the following characters: each wing is blackish-brown with a yellow stripe by its base beneath (as in the type species of Isapis) and on the hindwing. In DNA, a combination of the following characters is diagnostic in the nuclear genome: cne3301.6.2:T166A, cne3301.6.2:C186T, cne178.3.20:T1233A, cne178.3.20:T1632A, cne37196.1.3:A87T and in COI barcode: T67A, T82C, A211G, 223A, A268T, T625G.</p><p>Etymology. The name of the type species, pulcherrima, is a Latin word meaning very beautiful, most beautiful, or prettiest. The name of the new subgenus is formed from the Greek word Καλλίτερη (kallíteri), which means most beautiful. The name is a feminine noun in the nominative singular.</p><p>Species included. Only the type species.</p><p>Parent taxon. Genus Isapis E. Doubleday, 1847 .</p></div>	https://treatment.plazi.org/id/D20187A302648C3AFDCCF9BAFD62FE59	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3026B8C3AFDD0FDB9FD62FAEB.text	D20187A3026B8C3AFDD0FDB9FD62FAEB.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	(Grishin) Zhang & Cong & Shen & Song & Grishin 2023	<div><p>Matizada Grishin, new subgenus</p><p>http://zoobank.org/ 203DA466-AC54-4A5E-9BC5-44CE0AFD1F2F</p><p>Type species. Themone poecila H. Bates, 1868 .</p><p>Definition. As shown above, Themone poecila H. Bates, 1868 (type locality Brazil: Amazonas, Ega [= Tefé]) belongs to the genus Isapis E. Doubleday, 1847 (type species Papilio agyrtus Cramer, 1777) and not to Themone Westwood, 1851 (type species Helicopis pais Hübner, [1820]) (Fig. 21). However, it is genetically differentiated from the type species of Isapis at the subgenus level, e.g., their COI barcodes differ by 8.1% (53 bp) and is sister to the clade of two subgenera: Isapis and Callitera subgen. n. Therefore, we propose that the lineage with Isapis poecila represents a new subgenus. This subgenus differs from its relatives by a combination of the following characters: each wing is blackish-brown with a yellow-orange area towards the base and a central yellow spot, which may be vestigial on the dorsal side. In DNA, a combination of the following characters is diagnostic in nuclear genome: cne792.14.1:C927T, cne792.14.1:A132T, cne 2411.1.1:A348T, cne5004.10.6:A822T, cne5004.10.6:G633A, cne5335.1.1:C114C (not T), cne5335.1.1:T129T (not C), cne5331.3.1:A53A (not G), cne5331.3.1:T237T (not C), cne573.8.1: C63C (not G) and in COI barcode: A4C, C81T, T88A, A278A, 421C, A586A.</p><p>Etymology. The name of the type species, poecila, typically refers to colorful or variegated markings or patterns. It is derived from the Greek word ποικίλος (poikilos), which means varied, diverse, or multicolored. The name of the new subgenus is formed from the Spanish word matizado, which means variegated or mottled. The name is treated as a feminine noun in the nominative singular.</p><p>Species included. Only the type species.</p><p>Parent taxon. Genus Isapis E. Doubleday, 1847 .</p></div>	https://treatment.plazi.org/id/D20187A3026B8C3AFDD0FDB9FD62FAEB	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3026B8C3AFF4EFA08FD76F81E.text	D20187A3026B8C3AFF4EFA08FD76F81E.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Lyropteryx diadocis Stichel 1910	<div><p>Lyropteryx diadocis Stichel, 1910 belongs to the genus Paraphthonia Stichel, 1910 and not Lyropteryx Westwood, 1851</p><p>Genomic phylogeny reveals that Lyropteryx diadocis Stichel, 1910 (type locality in Brazil: Amazonas) kept in its original genus is not monophyletic with Lyropteryx Westwood, 1851 (type species Lyropteryx apollonia Westwood, 1851) and instead is sister to Paraphthonia Stichel, 1910 (type species Monethe molione Godman, 1903) (Fig. 21). Because Paraphthonia itself is already quite closely related to Brachyglenis C. Felder &amp; R. Felder, 1862 (type species Brachyglenis esthema C. Felder &amp; R. Felder, 1862) and Themone Westwood, 1851 (type species Helicopis pais Hübner, [1820]) (Fig. 21): COI barcode difference of 6.2% (41 bp) and 6.8% (45 bp), respectively, we restore monophyly of Lyropteryx by including L. diadocis in the genus Paraphthonia to form a new combination Paraphthonia diadocis (Stichel, 1910), comb. nov. Due to the genetic closeness of these three genera ( Paraphthonia, Brachyglenis, and Themone), it is conceivable to combine them in a single genus Themone, a step we are not taking here but proposing for consideration.</p></div>	https://treatment.plazi.org/id/D20187A3026B8C3AFF4EFA08FD76F81E	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3026A8C3BFDE5FF3AFC93FC6C.text	D20187A3026A8C3BFDE5FF3AFC93FC6C.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	(Grishin) Zhang & Cong & Shen & Song & Grishin 2023	<div><p>Parapanara Grishin, new subgenus</p><p>http://zoobank.org/ F41BC3E1-EAB0-44E4-A4F3-E9C9F8D04775</p><p>Type species. Lyropteryx diadocis Stichel, 1910 .</p><p>Definition. As shown above, Lyropteryx diadocis Stichel, 1910 (type locality in Brazil: Amazonas) belongs to the genus Paraphthonia Stichel, 1910 (type species Monethe molione Godman, 1903) and not to Lyropteryx Westwood, 1851 (type species Lyropteryx apollonia Westwood, 1851) (Fig. 21). However, it is genetically differentiated from the type species of Paraphthonia at the subgenus level, e.g., their COI barcodes differ by 6.1% (40 bp). Therefore, we propose that the lineage with Paraphthonia diadocis represents a new subgenus. This subgenus differs from its relatives by a combination of the following characters: forewing vein R 2 originates at the anterior distal corner of the discal cell, the forewing with the orange-yellow band from mid-costa to near tornus, and the hindwing with metallic-green overscaling around veins in distal half. In DNA, a combination of the following characters is diagnostic in the nuclear genome: cne3461.1.26:A146G, cne3461.1.26:A1989G, cne6404.2.4:C87T, cne945.5.1:A342T, cne945.5.1: T352C, cne3615.3.2:A132A (not G), cne4618.3.1:C31C (not G), cne4618.3.1:C37C (not G), cne6843.7.6: G489G (not A), cne6843.7.6:T525T (not C) and in COI barcode: T100A, C284T, T286A, A352C, T355A, A604G.</p><p>Etymology. In its appearance, the type species of this subgenus resembles some species from the genus Panara E. Doubleday, 1847 (type species Papilio jarbas Drury, 1782), and the prefix “para” means alongside, near, beyond, or similar to. The name is a feminine noun in the nominative singular.</p><p>Species included. Only the type species.</p><p>Parent taxon. Genus Paraphthonia Stichel, 1910 .</p></div>	https://treatment.plazi.org/id/D20187A3026A8C3BFDE5FF3AFC93FC6C	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3026A8C3BFF6FFB8FFC2FF9ED.text	D20187A3026A8C3BFF6FFB8FFC2FF9ED.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Synargis orestessa Hubner 1819	<div><p>Synargis orestessa Hübner, [1819] is a junior subjective synonym of Synargis soranus (Stoll, 1781), and Synargis arche (Hewitson, 1865) is a valid species</p><p>Synargis orestessa Hübner, [1819] was proposed as a replacement name for Papilio orestes Cramer, 1780 (type locality in Suriname) preoccupied by Papilio orestes Meerburgh, 1777 (in Papilionidae). Original illustrations (dorsal and ventral) (Cramer 1775 –1780) of P. orestes and a possible syntype specimen in RMNH that agrees with the illustrations and would simultaneously be a syntype of the replacement name S. orestessa look more similar to the original illustrations of Synargis soranus (Stoll, 1781) (type locality in Suriname) and specimens referred to by the name “ soranus,” than to specimens of the species currently referred to by the name “ orestessa .” Genomic analysis shows the presence of two species (Fig. 22) that differ by 3.2% (21 bp) in their COI barcodes: females of one possess broader yellow-orange bands on the forewing, and of the other have narrower and whiter bands usually separated into spots, among other differences. For these reasons, we propose that Synargis orestessa Hübner, [1819], stat. nov. is a junior subjective synonym of Synargis soranus (Stoll, 1781) . The oldest name for the species that was referred to by the name “ orestessa ” is Nymphidium arche Hewitson, 1865 (type locality in Brazil: Amazonas), and, hence, Synargis arche (Hewitson, 1865) is a valid species.</p></div>	https://treatment.plazi.org/id/D20187A3026A8C3BFF6FFB8FFC2FF9ED	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302698C38FEF4FF0CFDFEFE3D.text	D20187A302698C38FEF4FF0CFDFEFE3D.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Nothodanis Hirowatari 1992	<div><p>Nothodanis Hirowatari, 1992 is a subgenus of Danis [Fabricius], 1807</p><p>Genomic phylogeny of Polyommatini Swainson, 1827 reveals that Nothodanis Hirowatari, 1992 (type species Lycaena schaeffera Eschscholtz, 1821) (Fig. 23 cyan) is closely related to its sister genus Danis [Fabricius], 1807 (type species Papilio danis Cramer, 1775) (Fig. 23 violet), e.g., their COI barcodes differ by 10.2% (67 bp) and the two diverged from each more recently than most other genera (Fig. 23, on the right of the green line). Therefore, we propose to treat Nothodanis Hirowatari, 1992, stat. nov. as a subgenus of Danis [Fabricius], 1807.</p></div>	https://treatment.plazi.org/id/D20187A302698C38FEF4FF0CFDFEFE3D	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302698C38FE93FBA8FD3EFAC1.text	D20187A302698C38FE93FBA8FD3EFAC1.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Perpheres Hirowatari 1992	<div><p>Perpheres Hirowatari, 1992 is confirmed as a valid genus</p><p>Perpheres Hirowatari, 1992 (type and the only species Thysonotis perpheres (H. H. Druce &amp; Bethune-Baker, 1893) (Fig. 23 olive) was at times lumped with Danis [Fabricius], 1807 (type species Papilio danis Cramer, 1775), but is in a clade different from Danis (subtribe Danina Koçak &amp; Seven, 1997) and the same clade with Castalius Hübner, [1819] (type species Papilio rosimon Fabricius, 1775, subtribe Castaliina Distant, 1884) (Fig. 23). Therefore, the placement of T. perpheres in Danis is incorrect and, because Perpheres is genetically distant from genera that are closest to it (Fig. 23), we confirm Perpheres as a valid genus in the subtribe Castaliina .</p></div>	https://treatment.plazi.org/id/D20187A302698C38FE93FBA8FD3EFAC1	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302698C38FF60FAD8FF51F956.text	D20187A302698C38FF60FAD8FF51F956.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Pistoria Hemming 1964	<div><p>Pistoria Hemming, 1964 is a junior subjective synonym of Caleta Fruhstorfer, 1922</p><p>Adding DNA segments of Mambara nigropunctata Bethune-Baker, 1908 (type locality in Papua New Guinea, biosample SAMN18674175), the type species of currently valid genus Pistoria Hemming, 1964, taken from the alignment provided in Kawahara et al. (2023) (Fig. 23 red) to our genomic datasets of its relatives, we find that Pistoria nigropunctata originates within Caleta Fruhstorfer, 1922 (type species Lycaena caleta Hewitson, 1876), rendering it paraphyletic. To restore the monophyly, due to the genetic closeness of Pistoria nigropunctata and Caleta caleta (COI barcode difference of 5.9%, 39 bp), we propose that Pistoria Hemming, 1964, syn. nov. is a junior subjective synonym of Caleta Fruhstorfer, 1922 .</p></div>	https://treatment.plazi.org/id/D20187A302698C38FF60FAD8FF51F956	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302698C39FEC8F8AAFA87FEE1.text	D20187A302698C39FEC8F8AAFA87FEE1.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Upolampes Bethune-Baker 1908	<div><p>Upolampes Bethune-Baker, 1908 is a junior subjective synonym of Thaumaina Bethune-Baker, 1908</p><p>Genomic trees reveal that Upolampes Bethune-Baker, 1908 (type species Upolampes striata Bethune-Baker, 1908, which is a junior subjective synonym of Lycaena evena Hewitson, 1876) (Fig. 24b, Fig. 23 1908) (Fig. 24a, Fig. 23 green) are closely related to each other despite the remarkable difference in their wing patterns (Fig. 24): e.g., their COI barcode differ by 6.5% (43 bp) and therefore should be synonymous. The two names, Upolampes and Thaumaina, were published in the same work issued on the same date (Bethune-Baker 1908). As the first revisers, we give precedence to Thaumaina (two valid species, fewer name changes) over Upolampes (one valid species) and propose that Upolampes Bethune-Baker, 1908, syn. nov. is a junior subjective synonym of Thaumaina Bethune-Baker, 1908 .</p></div>	https://treatment.plazi.org/id/D20187A302698C39FEC8F8AAFA87FEE1	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302688C3EFE52FCBAFD56FE2B.text	D20187A302688C3EFE52FCBAFD56FE2B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Tarucus clathratus (Holland 1891)	<div><p>Tarucus clathratus W. Holland, 1891, comb. rest.</p><p>Genomic sequencing of the holotype by monotypy: “the type, a male,” per original description (Holland 1891), of Tarucus clathratus W. Holland, 1891 (type locality in Sulawesi, sequenced as NVG-20124E10) (Fig. 25, Fig. 23 magenta), currently placed in the genus Castalius Hübner, [1819] (type species Papilio rosimon Fabricius, 1775), reveals that it is not monophyletic with its type species and is in the same clade with Tarucus F. Moore, 1881 (type species Hesperia theophrastus Fabricius, 1793) (Fig. 23 blue), where it was originally placed. Therefore, we return it to the genus Tarucus, as originally proposed: Tarucus clathratus W. Holland, 1891, comb. rest. We note that the photograph of T. clathratus holotype in the original description (Holland 1891) (Fig. 25b) on a casual look does not appear particularly similar to overexposed or possibly re-touched) and a different position of antenna (was re-attached later). However, despite these differences, the wing shape and outline of the spread with the right hindwing closer to the forewing than the left pair, the position of tails, and the tear along the Rs vein in the middle of the right hindwing match between the likely holotype and the photograph. The specimen is in CMNH, bears the label “ Holland Collection”, agrees with the original description better than the photograph (broad dark bands per description), and is labeled in Holland’s handwriting as “Type” in a manner similar to all other type specimens he described and labeled. Therefore, there is little reason to doubt that the specimen we sequenced (NVG-20124E10) is the holotype.</p></div>	https://treatment.plazi.org/id/D20187A302688C3EFE52FCBAFD56FE2B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3026F8C3CFE39FD91FCB2FA61.text	D20187A3026F8C3CFE39FD91FCB2FA61.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Euriphellus colombiensis Zhang & Cong & Shen & Song & Grishin 2023	<div><p>Euriphellus colombiensis Grishin, new species</p><p>http://zoobank.org/ 466927D6-598F-4C73-8835-F3D4305F40BB (Figs. 26 part, 27a, c, 28a–b)</p><p>Definition and diagnosis. The Z chromosome analysis of Euriphellus Austin, 2008 (type species Papilio euribates Stoll, 1782) reveals that four specimens from Colombia and Ecuador form a clade sister to several Euriphellus species that is genetically differentiated from them (Fig. 26a). Therefore, these specimens belong to species distinct from the rest. The two pairs of specimens are genetically differentiated from each other, e.g., COI barcode differences of 4.9% (32 bp) between them (possible introgression with Euriphellus lama (Evans, 1952), Fig. 26b), and belong to two different new species. The one from western Colombia is described here, and the one from eastern Ecuador is described below. The new species from Colombia keys to D.4.2(b) in Evans (1952), and differs from its relatives by the following combination of characters in male: dorsal wing color yellower in hue, forewing without submarginal hyaline spots in cells M 1 -M 2, M 2 -M 3, or R 3 -R 4, only two yellow hyaline subapical spots in cells R 4 -R 5 and R 5 -M 1, hindwing with six well-developed and nearly collected into a band postdiscal brown spots on dorsal side, one in each cell between veins RS and 1A+2A, ventrally with prominent yellow spots, including near the base of cell Sc+R 1 -RS (Fig. 27a), tegumen narrower in dorsal view, harpe= longer= than= in= relatives,= humped= along= ventral= margin,= expanded= into= a= keel= with= several= small=teeth=on=dorsal=side=and=narrows=to=a=point,=ampulla=with=a=nearly=square=process,=flattened= along= its= somewhat= irregular= dorsoposterior= margin= (Fig.= 28a, b);= and= female= with= larger= discal= forewing=hyaline=spots,=the=spot=in=cell=M 3 -CuA 1 =overlaps=the=spot=in=cell=CuA 1 -CuA 2 =by=most=of=its= width= (Fig. 27c). Due to unknown phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly2582.35.2:G1861A, aly2582.35.2:C1862G, aly767.18.5:A88T, aly767.18.5:T117A, aly54.32.1:C215G and in COI barcode: A181G, T259C, C343T, T364C, T376A, T484T, T553A.</p><p>Barcode sequence of the holotype. Sample NVG-18052E08, GenBank OR837728, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATGTTAGGAACTTCTTTAAGTTTACTAATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAAATGATCAAATTTATAATACT ATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTAATGCCTATTATAATTGGGGGATTCGGAAACTGATTAGTACCATTAATATTAGGAGCCCCAGATATAGCTTTTCCACGAA TAAATAATATAAGATTCTGATTACTTCCCCCTTCTTTAATATTATTAATTTCAAGAAGAATCGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCTCCTTTATCTGCTAACATTGC CCATCAAGGATCATCAGTTGATTTAGCAATTTTTTCTCTTCACTTAGCTGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAACTTATCT TTCGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCTTTATTATTACTTCTCTCTTTACCAGTACTAGCAGGTGCAATTACTATATTATTAACAGACCGAAATTTTAATACAT CTTTTTTTGATCCTTCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany [MFNB], illustrated in Fig. 27a, bears four printed labels: 1 st green, two white [W.Columb. | Rio Dagua | 600- 1000m | W.Hopp S. | 2 - 5] (the last line is rotated 90° to the left and printed on the right margin of the label), [DNA sample ID: | NVG-18052E08 | c/o Nick V. Grishin], [DNA sample ID: | NVG-22111G11 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Euriphellus | colombiensis Grishin]. The first NVG number corresponds to a sampled leg, and the second is for the abdomen DNA extraction followed by genitalia dissection. Paratype: 1♀ with the same data as the holotype (NVG-18052E11, GenBank barcode OR837729, Fig. 27c).</p><p>Type locality. Colombia: Río Dagua, 600–1000 m .</p><p>Etymology. The name is given for the country of the type locality. The name is a masculine adjective.</p><p>Distribution. Currently known only from Colombia.</p></div>	https://treatment.plazi.org/id/D20187A3026F8C3CFE39FD91FCB2FA61	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3026D8C3DFE33F9BCFC86FBCD.text	D20187A3026D8C3DFE33F9BCFC86FBCD.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Euriphellus ecuadoricus Zhang & Cong & Shen & Song & Grishin 2023	<div><p>Euriphellus ecuadoricus Grishin, new species</p><p>http://zoobank.org/ 462B5465-AC20-4876-93A3-4803BB75CD2C (Figs. 26 part, 27b, d, 28c–d)</p><p>Definition and diagnosis. Genomic analysis of Euriphellus Austin, 2008 (type species Papilio euribates Stoll, 1782) reveals that four specimens from Colombia and Ecuador form a clade sister to several Euriphellus species that is genetically differentiated from them (Fig. 26). Therefore, these specimens belong to species distinct from the rest. The two pairs of specimens are genetically differentiated from each other, e.g., COI barcode differences of 4.9% (32 bp) between them, and belong to two different new species. The one from eastern Ecuador is described here, and the one from western Colombia is described above. The new species from Ecuador keys to D.4.2(b) in Evans (1952), and differs from its relatives by the following combination of characters in males: wings not as rounded as in Euriphellus mena (Evans,</p><p>submarginal hyaline spots in cells M1-M2, M2-M3, and R3 - R4, and larger hyaline subapical spots in cells R4 - R5 and R5 -M1, hindwing with five weaker-developed and separated postdiscal brown spots on dorsal side, one in each cell between veins RS and CuA2, ventrally with prominent yellow spots, but not near the base of cell Sc+ R1 -RS (Fig. 27b), tegumen broader in dorsal view, harpe shorter than in Euriphellus colombiensis sp. n., only weakly humped along ventral margin, no dorsal keel, and narrows to a point, ampulla with a rounded thumb-like process with somewhat irregular margins (Fig. 28c, d); and female with smaller discal forewing hyaline spots, the spot in cell M3-CuA1 offset distad from the spot in cell CuA1-CuA2 not overlapping with it (Fig. 27d). Due to unknown phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly331.26.8:C109A, aly331.26.8:G267A, aly331.26.8: T291 C, aly536.154.1:A618G, aly536. 154.1: T631 C and in COI barcode: A28G, T91 A, A229G, C343A, G474A, A538G, T544 A, T607 C, T634 C. Barcode sequence of the holotype. Sample NVG-18057G01, GenBank OR 837730, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGGGCAGGAATACTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAACTCCCGGTTCATTAATTGGAAATGATCAAATTTATAATACT ATTGTTACAGCCCATGCTTTTATTATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTACCATTAATATTAGGAGCCCCAGATATGGCTTTTCCACGAA TAAACAATATAAGATTTTGATTACTTCCACCTTCTTTAATATTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCACCTTTATCTGCTAATATTGC TCACCAAGGATCTTCAGTTGATTTAGCAATTTTTTCACTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAACTTATCT TTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCTTTATTATTGCTTCTATCTTTACCTGTATTAGCAGGTGCAATTACTATATTATTAACAGACCGAAATTTTAATACAT CCTTTTTTGATCCTTCTGGAGGAGGAGACCCTATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the Zoologische Staatssammlung München, Germany [ZSMC], illustrated in Fig. 27b, bears five printed labels: four white [Canelos | Ecuador or.], [Collection | v.Rosen], [DNA sample ID: | NVG-18057G01 | c/o Nick V. Grishin], [DNA sample ID: | NVG-23012A09 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Euriphellus | ecuadoricus Grishin]. The first NVG number corresponds to a sampled leg, and the second is for the abdomen DNA extraction followed by genitalia dissection. Paratype: 1♀ with the same data as the holotype (NVG-18057G02, GenBank barcode OR837731, Fig. 27d).</p><p>Type locality. Ecuador: Canelos .</p><p>Etymology. The name is given for the country of the type locality. The name is a masculine adjective.</p><p>Distribution. Currently known only from Ecuador.</p></div>	https://treatment.plazi.org/id/D20187A3026D8C3DFE33F9BCFC86FBCD	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3026C8C02FF58FB28FDBDFE2B.text	D20187A3026C8C02FF58FB28FDBDFE2B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Goniurus proteoides Plotz 1881	<div><p>Goniurus proteoides Plötz, 1881 is a junior subjective synonym of Urbanus proteus domingo (Scudder, 1872) and not of Urbanus proteus proteus (Linnaeus, 1758)</p><p>Genomic analysis of a syntype of Goniurus proteoides Plötz, 1881 (type locality in North America, NVG-15029D03) currently considered a junior subjective synonym of Urbanus proteus proteus (Linnaeus, 1758) (type locality in America) (Mielke 2005) reveals that it is not monophyletic with the latter and instead placed within specimens of Urbanus proteus domingo (Scudder, 1872) (type locality in Haiti), in agreement with Evans (1952) (Fig. 29). Therefore, we regard Goniurus proteoides Plötz, 1881 as a junior subjective synonym of Urbanus proteus domingo (Scudder, 1872) and not of Urbanus proteus proteus drawing t[afel].33 by Plötz of G. proteoides, wrote that he had its “Specimens from the Lesser Antilles in the G. &amp; S. coll.” To stabilize nomenclature, N.V.G. hereby designates the sole syntype curated in the MFNB collection, a male with the following five labels, the 2 nd handwritten and others printed, the 1 st red and others white: [Type], [proteoides | Pl. 104], [Coll. H.—Sch], [{QR Code} http://coll.mfn-berlin.de/u/ | e1f97d], and [DNA sample ID: | NVG-15029D03 | c/o Nick V. Grishin] as the lectotype of Goniurus proteoides Plötz, 1881 . The type locality of G. proteoides is in the Antilles (unclear if the Greater or the Lesser). Sequencing additional specimens of U. p. domingo across its range may pinpoint the type locality more precisely.</p></div>	https://treatment.plazi.org/id/D20187A3026C8C02FF58FB28FDBDFE2B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302538C00FE54FE44FA3DFF29.text	D20187A302538C00FE54FE44FA3DFF29.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Urbanus (Urbanus) cubanus Zhang & Cong & Shen & Song & Grishin 2023	<div><p>Urbanus (Urbanus) cubanus Grishin, new species</p><p>http://zoobank.org/ E1311827-75D9-4699-8E88-D7A317D9792A (Figs. 29 part, 30, 31a–e)</p><p>Definition and diagnosis. The nuclear genome tree reveals a prominent clade of two specimens from Cuba (Fig. 29 red) initially identified as Urbanus proteus domingo (Scudder, 1872) (type locality in</p><p>Haiti) that is sister to all other Urbanus proteus (Linnaeus, 1758) (type locality in America) we sequenced (Fig. 29 blue branches), and is placed approximately halfway between U. proteus and its sister species Urbanus velinus (Plötz, 1881) (type locality in Brazil: Bahia) (Fig. 29 green). The two specimens are strongly differentiated genetically from U. p. domingo (Fig. 29 violet, orange, and magenta labels), including two other specimens from Cuba (southeastern region) (Fig. 29 magenta labels): Fst / Gmin /COI barcode difference of 0.51/0.00/0.8% (5 bp, barcodes are similar between the two species). Therefore, these two specimens represent a species distinct from U. proteus . This new species keys to C.13.1(b) in Evans (1952) and differs from its closest relative U. proteus in broader and straighter ventral hindwing dark brown bands and a darker area by mid-costa, hyaline spot in forewing cell CuA 1 -CuA 2 closer aligned with the spot in discal cell rather than shifted distad, absent or small submarginal hyaline spots in forewing cells M 1 -M 2 and M 2 -M 3, and narrower antrum (Fig. 31 blue arrows). Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly103.33.9:A90G, aly103.33.9:T160C, aly103.33.9:G162C, aly207.9.6: A180G, aly103.50.3:T60C and in COI barcode: C220C, T322C, T385C, T610C, C616T.</p><p>Barcode sequence of the holotype. Sample NVG-18057F12, GenBank OR837732, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTCATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTAGTTCCATTAATAATAGGTGCCCCTGATATAGCTTTCCCCCGTA TAAATAATATAAGATTTTGATTATTACCCCCTTCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGTACCGGATGAACAGTCTATCCCCCTCTTTCATCTAATATTGC CCACCAAGGAGCTTCCGTTGACCTAGCAATTTTTTCTCTTCATCTTGCTGGAATTTCATCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTCTCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTCTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♀ deposited in the Zoologische Staatssammlung München, Germany [ZSMC], illustrated in Fig. 30a, bears six labels: four white, the 3 rd greenish [CUBA, La Habana, | Boyeros, Finca La | Chata (23.036 N, - | 82.376 W), July 9 2014 | R. Núñez leg.], [RNA-1-171], [BC ZSM Lep 92903], [DNA sample ID: | NVG-18057F12 | c/o Nick V. Grishin], [DNA sample ID: | NVG-23012A03 | c/o Nick V. Grishin], and one red [HOLOTYPE ♀ | Urbanus (Urbanus) | cubanus Grishin]. The first NVG number corresponds to a sampled leg, and the second is for the abdomen DNA extraction followed by genitalia dissection. Paratype: 1♀ Cuba, Gundlach leg., Coll. Thieme, genitalia vial NVG-22111G12 (NVG-21126H02, GenBank barcode OR837733, Fig. 30b) [MFNB].</p><p>Type locality. Cuba: Havana, Boyeros, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-82.376&amp;materialsCitation.latitude=23.036" title="Search Plazi for locations around (long -82.376/lat 23.036)">Finca La Chata</a>, GPS 23.036, −82.376 .</p><p>Etymology. The name is given for the country of the type locality. The name is a masculine adjective.</p><p>Distribution. Cuba; currently confirmed from the northwestern region (Havana).</p><p>reddish-brown, Fig. 30) is due to fading with age: the paratype was collected more than a century ago.</p></div>	https://treatment.plazi.org/id/D20187A302538C00FE54FE44FA3DFF29	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302518C00FEC7FF44FBC6FDA6.text	D20187A302518C00FEC7FF44FBC6FDA6.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Quadrus (Zera) difficilis (Weeks 1901)	<div><p>Quadrus (Zera) difficilis (Weeks, 1901) is confirmed as a species distinct from Quadrus (Zera) zera (A. Butler, 1870)</p><p>Although Quadrus (Zera) difficilis (Weeks, 1901) (type locality in Bolivia) is treated as a distinct species and not a subspecies of Quadrus (Zera) zera (A. Butler, 1870) (type locality in Venezuela), on the Butterflies of America website (Warren et al. 2023), this taxonomic opinion has not been substantiated numerically. Genomic sequencing of several specimens of both taxa reveals prominent genetic differentiation between them (Fig. 32), e.g., Fst /COI barcode difference of 0.30/2.7% (18 bp), thus confirming Quadrus (Zera) difficilis (Weeks, 1901) as a species-level taxon.</p></div>	https://treatment.plazi.org/id/D20187A302518C00FEC7FF44FBC6FDA6	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302518C01FEA5FC53FC63FE27.text	D20187A302518C01FEA5FC53FC63FE27.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Bolla subgisela Strand 1921	<div><p>Bolla subgisela Strand, 1921 is a junior subjective synonym of Staphylus melangon epicaste Mabille, 1903 and not of Bolla eusebius (Plötz, 1884)</p><p>Genomic analysis of the holotype of Bolla subgisela Strand, 1921 (type locality in Colombia), currently regarded as a junior subjective synonym of Bolla eusebius (Plötz, 1884) (type locality in Central America) reveals that it is not monophyletic with Bolla Mabille, 1903 (type species Bolla pullata Mabille, 1903 treated as a junior subjective synonym of Staphylus imbras Godman and Salvin, 1896), but instead is placed within specimens of Staphylus melangon (Mabille, 1883) (type locality in South America) and away from Staphylus tucumanus (Plötz, 1884) (type locality in Argentina), a sister species of S. melangon (Fig. 33). Therefore, B. subgisela is conspecific with S. melangon . The phylogenetic analysis we used does not differentiate between subspecies of S. melangon (Fig. 33), and we assign B. subgisela to subspecies by a combination of wing pattern characters and locality. Only Staphylus melangon epicaste Mabille, 1903 (type locality in Brazil) possesses brown ventral hindwing without dominant white overscaling toward tornus and inner margin, similar to B. subgisela, and it is the only subspecies documented from Colombia (Evans 1953). Therefore, we propose that Bolla subgisela Strand, 1921 is a junior subjective synonym of Staphylus melangon epicaste Mabille, 1903 .</p><p>from Gorgythion begga (Prittwitz, 1868)</p><p>Gorgythion marginata Schaus, 1902 (type locality in Peru) (Fig. 34 red) currently regarded as a junior subjective synonym of Gorgythion begga pyralina (Möschler, 1877) (type locality in Suriname) (Fig. 34 blue, part) is genetically differentiated from it and generally from Gorgythion begga (Prittwitz, 1868) (type locality in Brazil: Rio de Janeiro) at the species level (Fig. 34), e.g., Fst /COI barcode difference of 0.26/2.9% (19 bp). Therefore, we propose that Gorgythion marginata Schaus, 1902, stat. rest. is a species-level taxon distinct from Gorgythion begga (Prittwitz, 1868) .</p></div>	https://treatment.plazi.org/id/D20187A302518C01FEA5FC53FC63FE27	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302508C01FEEDFBA5FE50FA30.text	D20187A302508C01FEEDFBA5FE50FA30.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Gorgythion beggoides Schaus 1902	<div><p>Gorgythion beggoides Schaus, 1902 is a junior subjective synonym of Gorgythion begga begga (Prittwitz, 1868), not of Gorgythion plautia (Möschler, 1877)</p><p>Gorgythion beggoides Schaus, 1902 (type locality in Trinidad) (Fig. 34 orange) currently treated as a junior subjective synonym of Gorgythion plautia (Möschler, 1877) (type locality in Suriname) (Fig. 34 cyan) is not monophyletic with it and is instead placed within specimens of Gorgythion begga (Prittwitz, 1868) (type locality in Brazil: Rio de Janeiro) (Fig. 34 blue). Hence, we propose that G. beggoides and G. begga are conspecific. Due to extensive expression of white scaling around the tornus on the ventral hindwing, G. beggoides belongs to the nominotypical subspecies and not to Gorgythion begga pyralina (Möschler, 1877) (type locality in Suriname). Therefore, we propose that Gorgythion beggoides Schaus, 1902 is a junior subjective synonym of Gorgythion begga begga (Prittwitz, 1868), not of Gorgythion plautia (Möschler, 1877) .</p></div>	https://treatment.plazi.org/id/D20187A302508C01FEEDFBA5FE50FA30	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302508C07FE14FA50FBA3FDCF.text	D20187A302508C07FE14FA50FBA3FDCF.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Gorgythion guyanus Zhang & Cong & Shen & Song & Grishin 2023	<div><p>Gorgythion guyanus Grishin, new species</p><p>http://zoobank.org/ 75920045-0024-46CF-83F0-F53371D32E59</p><p>(Figs. 34 part, 35, 36)</p><p>Definition and diagnosis. Genomic analysis of Gorgythion Godman &amp; Salvin, 1896 (type species Helias pyralina Möschler, 1877) reveals that a specimen from Guyana (NVG-15043F10) (Figs. 34 magenta, 35) while being sister to Gorgythion begga (Prittwitz, 1868) (type locality in Brazil: Rio de Janeiro) (Fig. 34 blue), is not grouping closely with any of the described species (Fig. 34) and therefore is new. It exhibits COI barcode differences of 2.4% (16 bp) from Gorgythion begga pyralina (Möschler, 1877) (type locality in Suriname). This new species keys to E.36.1(a) in Evans (1953) and differs from its relatives in nearly unmarked dark-brown dorsal hindwing with convex outer margin, rounder than in Gorgythion plautia (Möschler, 1877) (type locality in Suriname) (Fig. 34 cyan), ventral hindwing without white area towards tornus, forewing not prominently truncate or produced at the apex, with developed markings and broad pale-brown areas (Fig. 35); left valva broader at the base, and expansion of its ampulla curved inward, appearing truncate in lateral view (Fig. 36). Due to unknown phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly1313.36.6:C75T, aly 1497.9.9:A87G, aly361.8.3:T111C, aly361.8.3:C126T, aly13198.6.3: G318C, aly 1204.4.2:G54G (not A), aly 1166.4.2:A30A (not C), aly 1166.4.2:T42T (not C), aly770.15.7:A12A (not G), aly770.15.7:G30G (not A) and in COI barcode: T59C, T172T, A181G, T280T, T463C, T574C.</p><p>AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCTTTAAGATTACTAATTCGAACTGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGGGGATTTGGAAATTGACTTGTTCCATTAATATTAGGAGCCCCTGATATAGCATTCCCCCGAA TAAATAATATAAGATTTTGACTTTTACCTCCTTCCCTTATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCTCCTCTTTCAGCTAATATTGC CCATCAGGGGGCATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAGAAATTTATCT TTTGATCAAATACCATTATTTGTTTGAGCAGTAGGTATTACTGCATTACTTTTATTATTATCATTACCTGTTTTAGCAGGTGCTATTACCATATTATTAACAGATCGAAATTTAAATACAT CATTTTTTGACCCTGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 35, bears five labels: four white [GUYANA: ESSEQUIBO | Mt. Wokomung, 3500 ft. | XI,1993; S. Fratello], [Genit. Vial No. | SRS-4628], [Allyn Museum | Acc. 1994-5], [DNA sample ID: | NVG-15043F10 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Gorgythion | guyanus Grishin].</p><p>Type locality. Guyana: Essequibo, Mt. Wokomung, elevation 3500 ft.</p><p>Etymology. The name is given for the country of the type locality. The name is a masculine adjective.</p><p>Distribution. Currently known only for the holotype collected in Guyana.</p></div>	https://treatment.plazi.org/id/D20187A302508C07FE14FA50FBA3FDCF	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302568C07FE6CFD31FB06FABE.text	D20187A302568C07FE6CFD31FB06FABE.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Pardaleodes murcia (Plotz 1883)	<div><p>Pardaleodes murcia (Plötz, 1883) is a species distinct from Pardaleodes incerta (Snellen, 1872)</p><p>Genomic analysis reveals that Hesperia murcia</p><p>(Plötz, 1883) (type locality not specified, syntype sequenced as NVG-21116G06), currently treated as a subspecies of Pardaleodes incerta (Snellen, 1872)</p><p>(type locality in Angola), is not monophyletic with it and is sister to the clade of P. incerta (Stoll, 1781)</p><p>together with Pardaleodes edipus (Stoll, 1781) (type locality in South Africa) (Fig. 37), genetically differentiated from them with Fst / Gmin /COI barcode difference of 0.61/0.00/4.6% (30 bp) ( P. incerta) and</p><p>0.64/0.00/5.0% (33 bp) ( P. edipus). Therefore, we Fig. 37. The nuclear genome tree (autosomes) of selected propose that Pardaleodes murcia (Plötz, 1883), stat. Pardaleodes species: P. edipus (violet), P. incerta (blue), P. murcia stat. rest. (red), P. tibullus (cyan), P. bule (olive), rest. is a species distinct from Pardaleodes incerta P. sator (green), and P. pusiella stat. rest. (magenta).</p><p>(Snellen, 1872). Sequencing a series of specimens from additional localities in western Africa and comparing them with genomic sequences of P. murcia syntypes may help in determining the type locality of this species more precisely .</p></div>	https://treatment.plazi.org/id/D20187A302568C07FE6CFD31FB06FABE	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302568C07FE79FA21FC83F919.text	D20187A302568C07FE79FA21FC83F919.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Pardaleodes pusiella Mabille 1877	<div><p>Pardaleodes pusiella Mabille, 1877 is a species distinct from Pardaleodes sator (Westwood, 1852)</p><p>Genomic analysis reveals that Pardaleodes pusiella Mabille, 1877 (type locality in Angola), currently regarded as a subspecies of Pardaleodes sator (Westwood, 1852) (type locality in Guinea), is genetically differentiated from it at the species level (Fig. 37): e.g., Fst / Gmin /COI barcode difference of 0.62/0.00/ 3.2% (21 bp). Therefore, we propose that Pardaleodes pusiella Mabille, 1877, stat. rest. is a species distinct from Pardaleodes sator (Westwood, 1852) .</p></div>	https://treatment.plazi.org/id/D20187A302568C07FE79FA21FC83F919	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302568C0AFEE0F97AFD50FC6D.text	D20187A302568C0AFEE0F97AFD50FC6D.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Semalea malawi	<div><p>Semalea malawi Grishin, 2023 is confirmed as a species-level taxon</p><p>Genomic sequencing of Hesperiidae from the CAS collection revealed a second confirmed specimen of Semalea malawi Grishin, 2023 (type locality in Malawi, holotype sequenced as NVG-19043B12), which is also a male as the holotype but was collected in northeastern Tanzania (Tanga District, Usambara Mts., Amani Malaria Station, elevation 300 ft, 6-Jan-1970, M. E. Irwin &amp; E. S. Ross leg., NVG-22108B02, CASENT 8568645) (Figs. 38b, 39). Compared to the holotype (Fig. 38a), it is yellower in the hue of paler scales (forewing patch, ventral overscaling, palpi, and cheeks), with a slightly shorter forewing orange patch, and has a small orange subapical spot on the forewing, more expressed on the ventral side (Fig. 39b). The COI barcode sequence of this specimen (GenBank OR837735) matches all 7 diagnostic characters given in the original description (Zhang et al. 2023b) but differs by 5 bp from the holotype. With this additional specimen, we carried out Fst / Gmin test to obtain the values 0.34/0.000 (with S. vibius (Hewitson, 1878)) and 0.55/0.000 (with S. rega (Mabille, 1889)) confirming S. malawi as a species.</p><p>http://zoobank.org/ E1AE8324-1FFE-4A14-916D-8BCC85B96105</p><p>(Figs. 40 part, 41)</p><p>Definition and diagnosis. Genomic sequencing of specimens from the southwesternmost population of Limochores mystic (W. H. Edwards, 1863) (type locality in USA: NY, Greene Co., Huner) reveals that they are sister to all other subspecies of L. mystic in the tree inferred from the nuclear genome (autosomes only) (Fig. 40a), although they fall among other L. mystic populations in the Z chromosome (not shown) and mitogenome trees (Fig. 40b), and their COI barcodes differ only due to variation. Therefore, this population is likely conspecific with L. mystic; however, being most divergent from all others, it represents a separate and new subspecies. In its duller look with more diffuse boundaries between brown ground color and yellow-orange spots, this subspecies is most similar to Limochores mystic dacotah (W. characters. Males have reduced orange scaling, spots and bands are narrower, e.g., the orange on the dorsal hindwing is reduced to a band approximately the same width as the brown margin, and the band is separated from the orange discal cell by a brownish belt. Both sexes have darker ventral sides of wings. Due to extensive phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly499.49.4:G66C, aly848.2.19:T51C, aly838. 7.2:C48T, aly838.7.2:T63C, aly1838.42.3:C34T.</p><p>Barcode sequence of the holotype. Sample NVG-22102C07, GenBank OR837736, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAACCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATACTAGGAGCTCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGATTTTGAATATTACCACCTTCACTAACATTGTTAATTTCAAGAAGAATTGTAGAGAATGGTGCAGGAACAGGTTGAACAGTTTACCCACCTTTATCTTCTAATATTGC ACATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCCGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCA TTTGATCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCTTTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTACTTACAGATCGAAATTTAAATACTT CATTTTTTGACCCAGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited the California Academy of Sciences, San Francisco, CA, USA [CAS], illustrated in Fig. 41a, bears seven printed (text in italics handwritten) labels: six white [Circle Bar Draw at | Tillman Ranch, 7100' | Coconino Co. AZ], [9 June 19 88 | collected by Kilian Roever], [COLLECTION OF | C. D. MacNeill], [ Polites mystic | ssp. nov. | Det.C.D.MacNeill '98], [DNA sample ID: | NVG-22102C07 | c/o Nick V. Grishin], [{QR Code} CASENT | 8566979], and one red [HOLOTYPE ♂ | Limochores mystic | nino Grishin]. Paratype: 1♀ same data as the holotype (NVG-22102C08, CASENT 8566980, Fig. 41b) [CAS].</p><p>Type locality. USA: Arizona, Coconino Co., Circle Bar Draw at Tillman Ranch, 7100 '.</p><p>Etymology. The name is formed from the name of the county of the type locality [Coco] nino and is a noun in apposition.</p><p>Distribution. Only known from central Arizona, USA. Populations in southwestern Colorado should be studied to determine their taxonomic identity.</p></div>	https://treatment.plazi.org/id/D20187A302568C0AFEE0F97AFD50FC6D	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025B8C0AFF62FB89FB21FA06.text	D20187A3025B8C0AFF62FB89FB21FA06.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Hesperia pahaska Leussler 1938	<div><p>Hesperia pahaska Leussler, 1938 populations in most of New Mexico and the White Mountains, Arizona are the nominal subspecies, not H. p. williamsi Lindsey, 1940</p><p>Genomic trees of Hesperia pahaska Leussler, 1938 (type locality in USA: Nebraska, Sioux Co.) reveal that a specimen from southeastern New Mexico (Lincoln Co., NVG-22057C03) and specimens from the White Mountains in Arizona are not in the same clade with Hesperia pahaska williamsi Lindsey, 1940 (type locality in USA: Arizona, Pima Co. Baboquivari Mts., holotype sequenced as NVG-15096B10), a subspecies they were usually attributed to, but are within specimens of the nominal H. pahaska (Fig. 42). Therefore, we deduce that populations in most of New Mexico and eastern Arizona are H. pahaska pahaska, while the specimens from southwestern New Mexico remain to be studied.</p></div>	https://treatment.plazi.org/id/D20187A3025B8C0AFF62FB89FB21FA06	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025B8C08FE8FFA62FBB0FC60.text	D20187A3025B8C08FE8FFA62FBB0FC60.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Hesperia pahaska subsp. hannawackeri Zhang & Cong & Shen & Song & Grishin 2023	<div><p>Hesperia pahaska hannawackeri Grishin, new subspecies</p><p>http://zoobank.org/ FC3A2704-0C47-4FEC-8476-2947275E52FD</p><p>(Figs. 42 part, 43)</p><p>Definition and diagnosis. Populations of Hesperia pahaska Leussler, 1938 (type locality in USA: Nebraska, Sioux Co.) from southeastern Utah and southwestern Colorado are usually included in Hesperia pahaska martini MacNeill, 1964 (type locality USA: California, San Bernardino Co., 4.5 mi SE of Ivanpah). However, they form a distinct clade in the Z chromosome tree and possess a distinct mitochondrial genome haplotype (Fig. 42 red), representing distinct subspecies. This new subspecies differs from H. p. martini in better outlined and contrasting with fulvous ground color brown outer margins, smaller forewing subapical spots, and usually smaller ventral hindwing white spots; from the nominal Hesperia pahaska by less contrasting with the fulvous colors subapical and submarginal dorsal forewing spots, which are typically paler in H. p. pahaska, and usually more extensive fulvous areas penetrating fuscous margins in females on wings above (more similar to H. p. williamsi in this aspect) and from Hesperia pahaska williamsi Lindsey, 1940 (type locality in USA: Arizona, Pima Co., Baboquivari Mts) by generally larger white ventral hindwing spots. Due to extensive phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly5021.3.8:C60T, aly7690.1.10:C45A, aly7690.1.10:C204T, aly4196.3.1:C333G, aly4196. 3.1:A415G and in COI barcode: T10C, T19C, G101A, 328C, T646C.</p><p>AACTTTATACTTTATTTTCGGTATTTGAGCTGGTATATTAGGAACTTCATTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATCTTTAATTGGAAATGACCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGACATAGCTTTCCCACGTA TAAATAATATAAGATTTTGAATATTACCACCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGCTGAACTGTTTATCCTCCTTTATCCTCTAATATTGC TCACCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCACTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAACTTATCT TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATACTACTTACTGATCGAAATTTAAATACTT CTTTTTTCGATCCAGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 43a, bears four printed labels: two white [Pack Creek Day Use Area | La Sal Mountains | San Juan Co, UT | 2 June 2016 | Robb Hannawacker], [ Pahaska Skipper | male | Hesperia pahaska], [DNA sample ID: | NVG-20045F06 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Hesperia pahaska | hannawackeri Grishin]. Paratypes: 5♂♂ 2♀: USA: 1♀ Utah, San Juan Co., Poison Canyon, el. 8500', 5-Jun-2020, R. Hannawacker leg. (NVG-20045F05) (Fig. 43b); Colorado: Mesa Co.: 2♂♂ Black Ridge Breaks, West Reef, 7050 ft, 24-25- May-2007, M. S. Fisher leg. (NVG-22055G08 &amp; NVG-22055G09); and 1♂ BLM lands W of Gateway, Unaweep Seep Natural Area, 10-Sep-2017, Paul A. Opler and Evi M. Buckner-Opler leg. (PAO 566); 1♂ Delta Co., 4.6-7.3 mi. SE of Austin, 6000-6600 ft, 12-Jun-1983, M. S. Fisher leg. (NVG-22055G10); 1♂ 1♀ Montrose Co., Gunnison Gorge NWA, Wave-Eagle Trail Loop, 6000-6300 ft, 1- and 3-Jun-2016, M. S. Fisher leg. (NVG-22055G11 &amp; NVG-22055G12).</p><p>Type locality. USA: Utah, San Juan Co., La Sal Mountains, Pack Creek Picnic Area .</p><p>Etymology. The name honors Robb Hannawacker, the collector of the holotype and a female paratype from Utah. Robb is a dedicated Lepidopterist and the author of the book on the butterflies of southeastern Utah. He helped our lab tremendously with genomic studies of butterflies from his region (southeastern Utah) by collecting specimens and connecting us with others who can help further. The name is a masculine noun in the genitive case.</p><p>Distribution. Southeastern Utah and southwestern Colorado in the USA.</p></div>	https://treatment.plazi.org/id/D20187A3025B8C08FE8FFA62FBB0FC60	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302598C0EFE6CFBB8FA33FCAB.text	D20187A302598C0EFE6CFBB8FA33FCAB.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Pseudocopaeodes eunus subsp. ash	<div><p>Pseudocopaeodes eunus ash Grishin, new subspecies</p><p>http://zoobank.org/ 9EB3AEE9-E29D-4684-9A7D-1EB65A9C6FB5 (Figs. 44 part, 45a)</p><p>Definition and diagnosis. Genomic sequencing of Pseudocopaeodes eunus (W. H. Edwards, 1881) (type locality USA: Kern Co., the bottoms of Kern River, near Bakersfield) populations reveals that specimens from the Ash Meadows area in southern Nevada are not monophyletic with Pseudocopaeodes eunus alinea J. Scott, 1981 (type locality in USA: California, San Bernardino Co., Afton Canyon) despite the similarity in being less marked than other populations, and form a distinct clade with genetic differentiation larger than for some other P. eunus subspecies (Fig. 44), e.g., their COI barcodes differ by 1.1% (7 bp). Therefore, the Ash Meadows population represents a new subspecies. This subspecies is most similar to P. e. alinea in appearance and differs from it in having less conspicuous and thinner</p><p>In particular, palpi beneath, cheeks, area by ventral forewing costa at the wing base, forewing apex, and hindwing overall are whiter (and wing venter redder) than in P. e. alinea, which is yellower (Fig. 45b). Dorsal hindwing by the apex is usually less dark, and dark scales by the costa are confined mostly to the base. Definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly 1022.2.1:G558A, aly 1781.2.2:C384 T , aly 1781.2.2:G444A, aly4645.18. 2:C183 T, aly4645.18.2: T213 A and in COI barcode can be distinguished from other subspecies, except Pseudocopaeodes eunus obscurus Austin &amp; J. Emmel, 1998 (type locality in USA: Nevada, Carson City): A214A, T220 C, A484A, T514 T, 604C.</p><p>Barcode sequence of the holotype. Sample NVG-21049E06, GenBank OR837738, 658 base pairs: AACTTTATATTTTATTTTTGGTATCTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATAGT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCCCCAGATATAGCTTTCCCACGAA TAAATAATATAAGATTTTGAATATTACCCCCATCATTAATATTATTAATCTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGTTGAACTGTTTATCCTCCTTTATCTTCTAATATTGC TCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCA TTTGACCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCTTTATTATTATTATTATCTTTACCTGTATTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACCT CTTTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 45a, bears four labels, 1 st handprinted others printed: three white [ASH MEADOWS | NYE CO. NEV. | 2 SEPT. 1989 | LEG:P. SAVAGE], [P Savage colln. | MGCL Acc. | 2006-15], [DNA sample ID: | NVG-21049E06 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Pseudocopaeodes | eunus ash Grishin]. Paratypes: 2♂♂ 2♀♀ same locality as the holotype: 2♂♂ 6-Sep-1987, P. Savage colln. (NVG-22076F04 and NVG-22076F05) [MGCL], 1♀ 7-Sep-1988, P. Savage leg. (NVG-21049E07) [MGCL], and 1♀ 12-Aug-1984 G. T. Austin leg. (NVG-20063G12, CSU _ ENT 1028906) [CSUC].</p><p>Etymology. The name is given for the type locality and the ashier appearance: paler, whiter, ventrally dusted with white compared to other subspecies. The name is treated as a masculine noun in apposition.</p><p>Distribution. Southern Nevada; known only from the Ash Meadows area.</p><p>Comments. First, we note that where P. eunus is double-brooded, the two broods differ in appearance. The first one produces darker specimens with broader dark-framed veins and more conspicuous two pale rays of the ventral hindwing, thus having a classical P. eunus appearance. The second brood produces paler specimens. Therefore, wing patterns within the broods should be compared between populations to reach meaningful conclusions. Second, we see that genetic differentiation between the two subspecies Pseudocopaeodes eunus obscurus Austin &amp; J. Emmel, 1998 (type locality in USA: Nevada, Carson City) and Pseudocopaeodes eunus flavus Austin &amp; J. Emmel, 1998 (type locality in USA: Nevada, Churchill Co.) is limited compared to others (Fig. 44), suggesting that they are not particularly distinct from each other, despite their phenotypic difference in wing patterns. Thus, wing patterns can differ with very few genetic changes. Third, we observe the genetic similarity between the lectotype of Copaeodes wrightii W. H. Edwards, 1882 (type locality USA: California, San Bernardino Co., nr. Victorville) currently treated as a junior subjective synonym of the nominal P. eunus and the type series of Pseudocopaeodes eunus alinea J. Scott, 1981 (type locality USA: California, San Bernardino Co., Afton Canyon) (Fig. 44). While additional analyses are required, it may be that C. wrightii is not a synonym of P. e. eunus, but instead is a valid subspecies and the same taxon as P. e. alinea, with the latter being its junior subjective synonym.</p></div>	https://treatment.plazi.org/id/D20187A302598C0EFE6CFBB8FA33FCAB	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025F8C0EFEE6FCC8FC8AF9E0.text	D20187A3025F8C0EFEE6FCC8FC8AF9E0.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Pamphila milo W. H. Edwards 1883	<div><p>Pamphila milo W. H. Edwards, 1883 is a junior subjective synonym of Ochlodes agricola verus (W. H. Edwards, 1881)</p><p>The holotype of Pamphila milo W. H. Edwards, 1883 was stated to be from “Mt. Hood, Oregon ”, and later from Thurston Co., Washington, where this species is not known to occur (Pelham 2008; Pelham 2023). Genomic analysis of the holotype (NVG-15036C12) places it within specimens of Ochlodes agricola verus (W. H. Edwards, 1881) (type locality USA: California, Kern Co., Havilah) from Kern Co., California that include the lectotype of the latter</p><p>(NVG-15096F09) (Fig. 46). Therefore, we propose that Pamphila milo W. H. Edwards, 1883 is a junior subjective synonym of Ochlodes agricola verus (W.</p><p>H. Edwards, 1881), and not of Ochlodes agricola nemorum (Boisduval, 1852) (type locality in USA:</p><p>California, Plumas Co.) as currently treated. While sequencing of additional specimens of Ochlodes agricola (Boisduval, 1852) (type locality in USA:</p><p>California, Marin Co.) for population analysis is needed for confident conclusions, our phylogenetic Fig. 46. The nuclear genome tree (autosomes) of Ochlodes analysis tentatively suggests that the type locality of agricola subspecies: O. a. agricola (blue), O. a. nemorum P. milo might have been in Kern Co., California, (green), and O. a. verus (violet, with its junior subjective synonym Pamphila milo in magenta).</p><p>possibly even “Havilah”, together with O. a. verus.</p></div>	https://treatment.plazi.org/id/D20187A3025F8C0EFEE6FCC8FC8AF9E0	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025F8C0FFE4CF93DFAEDFCBF.text	D20187A3025F8C0FFE4CF93DFAEDFCBF.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Hesperia amanda Plotz 1883	<div><p>Hesperia amanda Plötz, 1883 is a nomen dubium</p><p>Suggested as a probable variation of Hesperia ottoe W. H. Edwards, 1866 (type locality in USA: Kansas) by Godman (1907) and placed as a junior subjective synonym of Ochlodes sylvanoides napa (W. H. Edwards, 1865) (type locality in USA: Colorado, Clear Creek Co.) by Evans (1955), Hesperia amanda Plötz, 1883 (type locality not stated and unknown) was described in an identification key from at least one male with a forewing length of 13 mm (Plötz 1883). Relevant parts of the key are translated and combined here as: “Upperside reddish-yellow. Forewing with a diagonal, wide, dark brown stigma that brown longitudinal spot in cell 5. Forewing margin widely brown. Hindwing margin less wide,</p><p>especially on the inner margin, narrow and pale brown. Hindwing underside reddish-yellow with a faded yellow band”. Published on plate 180 (row i,</p><p>images 4 and 5 from the left) illustration of H.</p><p>amanda in Draudt (1921 –1924) (Fig. 47) is,</p><p>according to our reading of Evans (1955), paler than inspected by Evans copy of Plötz’s original drawing</p><p>t[afel]. 617. Indeed, Draudt’s illustration agrees well with the original description and likely reflects the appearance of this species. In our opinion, H.</p><p>amanda is conspecific neither with H. ottoe nor with O. s. napa largely because the stigma in H. amanda extends into cell 3 (i.e., M 3 -CuA 1), forewing brown streak distad of the discal cell is confined to the cell 5 (i.e., M 1 -M 2), and the inner margin of dorsal hindwing is only narrowly brown, with a paler-brown outer margin by the tornus. These characters do not match the former two species. The stigma reaches into cell 3 in many Indo-Australian Hesperiidae, but we are not able to associate H. amanda with any species known to us. Therefore, we propose to treat this name as nomen dubium, pending further research.</p></div>	https://treatment.plazi.org/id/D20187A3025F8C0FFE4CF93DFAEDFCBF	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025E8C0CFF33FCDAFC3DFE06.text	D20187A3025E8C0CFF33FCDAFC3DFE06.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Ochlodes napa (W. H. Edwards 1865)	<div><p>Ochlodes napa (W. H. Edwards, 1865) and Ochlodes santacruza J. Scott, 1981 are species distinct from Ochlodes sylvanoides (Boisduval, 1852)</p><p>Genomic analysis of specimens identified as Ochlodes sylvanoides (Boisduval, 1852) (type locality in USA: California, Plumas Co.) reveals their partitioning into three prominent clades genetically differentiated at the level typical for distinct species (Fig. 48 green, red with magenta, and blue). The first clade (Fig. 48 green) corresponds to populations from the Islands of the California coast: Santa Cruz Island and Santa Catalina Island. The senior name for these populations is Ochlodes sylvanoides santacruza J. Scott, 1981 (type locality USA: California, Santa Barbara Co., Santa Cruz Island). The second clade (Fig. 48 red and magenta, two clades in mitochondrial genome tree Fig. 48b, likely due to introgression) includes populations from the eastern part of the range (Colorado, southeastern Utah, and Arizona) and is currently represented by one name, Ochlodes sylvanoides napa (W. H. Edwards, 1865) populations (Oregon, mainland California, Nevada) and includes the nominotypical subspecies O. sylvanoides sylvanoides . Fst / Gmin /COI barcode difference among these clades are: 0.43/0.003/2.1% (14 bp) (O. s. sylvanoides vs. O. s. napa), 0.33/0.01/1.7% (11 bp) (O. s. sylvanoides vs. O. s. santacruza), and 0.54/0.008/2.6% (17 bp) (O. s. napa vs. O. s. santacruza). Therefore, we propose that Ochlodes napa (W. H. Edwards, 1865), stat. rest. and Ochlodes santacruza J. Scott, 1981, stat. nov. are species distinct from Ochlodes sylvanoides (Boisduval, 1852) and form a new species-subspecies combination: Ochlodes santacruza catalina J. Emmel &amp; T. Emmel, 1998, comb. nov.</p></div>	https://treatment.plazi.org/id/D20187A3025E8C0CFF33FCDAFC3DFE06	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025D8C0DFE3DFE63FBB8FCA6.text	D20187A3025D8C0DFE3DFE63FBB8FCA6.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Ochlodes napa subsp. kaibab Zhang & Cong & Shen & Song & Grishin 2023	<div><p>Ochlodes napa kaibab Grishin, new subspecies</p><p>http://zoobank.org/ 0CF5A2B5-E6B9-460A-999F-500EFEFE3921</p><p>(Figs. 48 part, 49)</p><p>Definition and diagnosis. Genomic sequencing reveals that specimens of Ochlodes napa (W. H. Edwards, 1865), stat. rest. (type locality in USA: Colorado, Clear Creek Co.) from the southwestern part of the range are genetically differentiated from the rest (Fig. 48) with the COI barcode difference of 2.0% (13 bp). This difference is large because they possess mitochondrial genomes (and therefore COI barcodes) more similar to Ochlodes sylvanoides (Boisduval, 1852) (type locality in USA: California, Plumas Co.) than to O. napa (Fig. 48b). Due to this genetic differentiation, these populations from Coconino Co. in Arizona represent a distinct taxon that currently does not have a name and therefore is new. We consider it to be a subspecies of O. napa because genetic differentiation in the nuclear genome is not prominent (Fig. 48a), and we are not aware of this new taxon being sympatric with O. napa . This new subspecies is characterized by a darker appearance, sharper edges of brown areas likely caused by reduced fulvous overscaling over the brown areas, especially near their edges (e.g., the brown spot distad of the discal cell on forewing), and submarginal spots in cells M 1 -M 2 and M 2 -M 3 are better separated from fulvous areas of the forewing. Its females tend to have more developed fulvous areas in the forewing provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly 1500.7.2:A162T, aly 1500.7.2:T170A, aly3598.15.2:G447A, aly3598.15.2:C459T, aly378.20.4:A390G and in COI barcode: A217A, A256C, T439C, T505C, T583T, T616C.</p><p>Barcode sequence of the holotype. Sample NVG-21113C07, GenBank OR837739, 658 base pairs: AACTTTATACTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGTGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAA TAAATAATATAAGCTTTTGAATATTACCTCCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTATATCCTCCTTTATCTTCTAATATTGC TCACCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCATCTATTCTAGGAGCTATCAATTTTATTACAACAATTATTAATATACGAATTAAAAACTTATCA TTTGATCAAATACCCTTATTCGTATGATCAGTAGGTATTACAGCATTATTATTATTATTATCTTTACCTGTCTTAGCAGGTGCTATTACAATATTACTTACTGATCGAAATTTAAATACTT CTTTTTTTGACCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 49a, bears four printed labels: three white [South Canyon Spring | Kaibab Plateau, AZ | 30 July 2021 | Robb Hannawacker], [Woodland Skipper | Ochlodes sylvanoides | male], [DNA sample ID: | NVG-21113C07 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ Ochlodes napa | kaibab Grishin]. Paratype: 1♀ same data as the holotype (NVG-21113C06) (Fig. 49b).</p><p>Type locality. USA: Arizona, Coconino Co., Kaibab Plateau, South Canyon Spring .</p><p>Etymology. The name is a noun in apposition taken from the type locality of this species.</p><p>Distribution. Northern Arizona, USA. Populations in southeastern Utah are the nominal subspecies, and those in southwestern Utah should be studied to determine their identity.</p></div>	https://treatment.plazi.org/id/D20187A3025D8C0DFE3DFE63FBB8FCA6	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025C8C11FE81FCC3FDC3FCA7.text	D20187A3025C8C11FE81FCC3FDC3FCA7.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Hesperia erratica Plotz 1883	<div><p>Lectotype designation for Hesperia erratica Plötz, 1883</p><p>Hesperia erratica Plötz, 1883 (type locality in Guatemala), currently a junior subjective synonym of Lon zabulon (Boisduval &amp; Le Conte, [1837]) (type locality in North America, possibly USA: Georgia), was described from an unstated number of specimens from Guatemala (Plötz 1883). One specimen, shown in Fig. 50a, is curated in the MFNB collection as a syntype of H. erratica . We determine that this specimen is indeed a syntype. First, it agrees with the original description, which we translate as: “Yellow on both sides, all wings dark at the base and outer margin. Hindwing underside straw-yellow, at the base pale-brown with yellow spot, cell 1b is overscaled with pale-brown. Three such spots are in an oblique line in cell 1c, 2, and 3, one spot in the discal cell near the brown base, and a patch in the corner of cell 6. In cell 7 at the apex, there is a small brown spot, like the previous ones, and in cell 6, the narrow uneven border begins, ending at vein 1b. Upperside dark-yellow, forewing with brown-powdered [refers to the following list], the apical spots ending at the costal margin, such long spot in cells 4 and 5, and a dark brown cross vein. Hindwing with a brown costal margin, narrow in cells 4 and 5, then rapidly widening outer border, and a broad inner margin. Fringes of the forewing light brown, and of the hindwing yellow.” The description does not mention a diffuse discal spot in hindwing cell 5 (i.e., M 1 -M 2) beneath, present in the syntype, but all its other characters are in very good agreement with the description.</p><p>Second, according to its labels, this candidate syntype specimen from the Weymer collection was seen by Plötz, who identified it at the time as “ zabulon Bd. ” (“best[immt]. v[on]. Plötz”). Subsequently, Plötz likely changed his mind because, in his publication with the key describing H. erratica, he placed it after his “ zabulon ”, which was actually Lon hobomok (T. Harris, 1862) (type locality in USA: Massachusetts) (Plötz 1883). This is also corroborated by the opinion of Godman (1907), who inspected the original Plötz drawings of “ zabulon ” (t[afel]. 655) “from Buffalo” and concluded that they “represent A. hobomok .” Thus, Plötz’s “ zabulon ” was L. hobomok, and Plötz probably proposed the name erratica for the true L. zabulon, represented by this specimen, after he realized that two species were involved (see specimen labels below). Third, the specimen bears a label with “Erratica Plötz i l.” in Weymer’s handwriting, meaning that this name was given to Weymer by Plötz before publication of the name (therefore “i. l.”, for “in litteris”). Fourth, Godman (1907), who inspected Plötz original drawing of H. erratica (t[afel]. 656), identified it as male “ Atrytone zabulon ” in accord with the identity of the syntype.</p><p>We were not able to find other syntypes, and to stabilize nomenclature, N.V.G. hereby designates the sole syntype in the MFNB collection, a male with the following seven printed (but 2 nd, 3 rd, and 4 th</p><p>and. Art], [ Erratica Plötz i l. | taf. 656. Guatemala], [ Erratica Pltz | i.l. | Guatemala], [Coll. Weymer], [{QR Code} http://coll.mfn-berlin.de/u/ | 44a0bc], and [DNA sample ID: | NVG-18052B03 | c/o Nick V. Grishin] as the lectotype of Hesperia erratica Plötz, 1883 . The last two lines on the 2nd label are abbreviated and should read “no 92 bestimmt von Plötz | ist möglicherweise andere Art”, which we translate as “no 92 identified by Plötz | is possibly a different species”, an indication that Plötz would change his opinion about the determination of this specimen as “zabulon .” The COI barcode sequence of H. erratica lectotype, sample NVG-18052B03, GenBank OR837740, 658 base pairs, is: AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACTTCTCTTAGATTACTAATTCGAACTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTCTTATACTAGGAGCTCCTGATATAGCATTTCCACGAA TAAATAACATAAGATTTTGATTATTACCTCCATCATTAACATTATTAATTTCAAGAAGAATTGTCGAAAATGGTGCTGGTACTGGATGAACAGTTTACCCCCCTTTATCAGCAAATATTGC TCACCAAGGTTCTTCCGTAGATTTAGCAATCTTTTCTTTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCT TTTGATCAAATACCATTATTTATTTGAGCTGTAGGAATTACAGCATTATTATTACTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACAT CTTTCTTTGACCCAGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT as a junior subjective synonym of Lon zabulon (Boisduval &amp; Le Conte, [1837])</p><p>Genomic tree of specimens identified as Lon zabulon (Boisduval &amp; Le Conte, [1837]) (type locality in North America, possibly USA: Georgia) reveals that the lectotype of Hesperia erratica Plötz, 1883 (type locality in Guatemala, sequenced as NVG-18052B03, Fig. 50a) is in the clade with specimens from the USA (Fig. 51 violet) and not with specimens from Mexico and Central America, including El Salvador and Costa Rica (Fig. 51 blue, a species different from L. zabulon, see below). Therefore, we confirm H. erratica as a junior subjective synonym of L. zabulon but propose that its type locality given as ‘Guatemala’ in the original description and on the lectotype labels was erroneous and should be corrected to the USA. Sequencing of L. zabulon specimens across the range will allow us to determine the type locality more precisely.</p><p>Even from the wing patterns of the lectotype, as also hinted in the original description of H. erratica, it is more likely to be from the United States than Guatemala. First, orange-yellow on the dorsal forewing is more extensive than in Central American specimens, i.e., the triplet of subapical spots is connected to the doublet of submarginal spots (Fig. 50a), while in Central American specimens, they are typically well-separated from each other (Fig. 50b). This character is also described for H. erratica by Plötz (1883) as a “long spot in cells 4 and 5”, meaning that there is a yellow background (i.e., “upperside dark-yellow”) that is formed by subapical and submarginal yellow spots together with the rest of the wing (except the marginal brown border) and there is a separate brown spot on this background. Instead, specimens from Central America would be described as having 3 yellow subapical and 2 submarginal spots on a brown background by the apex. Second, the ventral hindwing brown border by the outer margin is described by Plötz as “narrow uneven” (Fig. 50a), which is more typical for specimens from the US. This border is usually broader and more even in Central American specimens (Fig. 50b).</p><p>Looking more into the discrepancy about the type locality, we find that only two species of Hesperiidae proposed by Plötz have the type locality listed as “ Guatemala.” In addition to H. erratica, the second one is Achlyodes gorgona Plötz, 1884, a junior subjective synonym of Gesta invisus (Butler &amp; H. Druce, 1872) . A possible syntype of A. gorgona is from the Möschler collection (now in MFNB). It was collected in Guatemala in 1884 according to its dedicated locality/collector/date green label, which is likely correct. The type(s) of H. erratica would have been from an earlier collection event because the name was published in 1883. Moreover, unlike A. gorgona, it lacks a dedicated locality label. Therefore, it is unclear whether the type locality in Guatemala is accurate for H. erratica . Localities for the specimens collected in the US were known to be incorrect or missing. At least two mistakes have been documented. First, Goniloba parumpunctata Herrich-Schäffer, 1869 (type locality not stated in the original description, but later assumed to be in South America, possibly Venezuela), which is a junior subjective synonym of Lerema accius (J. E. Smith, 1797) (type locality in USA: Georgia) had the locality of the lectotype (male) and at least one female paralectotype deduced to be in eastern US by genomic sequence comparison (Zhang et al. 2023a). Second, Pyrgus argina Plötz, 1884 (type locality given as “Brisbane” [Australia]), which is a junior subjective synonym of Amblyscirtes hegon (Scudder, 1863) (type locality in USA: New Hampshire, White Mountains), is only known from the USA (Evans 1949).</p><p>http://zoobank.org/ AA859D18-CFC6-47F8-9032-AB5B6D79EB69</p><p>(Figs. 50b, 51 part, 52)</p><p>Definition and diagnosis. Genomic trees of specimens identified as Lon zabulon (Boisduval &amp; Le Conte, [1837]) (type locality in North America, possibly USA: Georgia) reveal their partitioning into three clades: from the USA, which is L. zabulon in accord with its phenotype and the type locality, and two others that do not have names (Fig. 51). One of these clades consists of specimens from Mexico and Central America (Fig. 51 blue) and differs from L. zabulon by Fst / Gmin /COI barcode of 0.49/0.01/3% (20 bp) thus representing a new species. This species differs from L. zabulon in reduced orange-yellow areas on wings, e.g., broader brown borders and a smaller, disconnected triplet of subapical spots and a doublet of submarginal spots on forewing; ventral hindwing with broader and more even outer border and larger spots (Fig. 50b); the process of aedeagus is more robust (Fig. 52a, e–j). Definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly596.8.5:A189G, aly596.8.5:A192T, aly806.32.1:T876C, aly806.32.1:A1101G, aly1097.21.1:G46A and in COI barcode: T82C, G101A, T292C, C376T, T457C, T478C.</p><p>Barcode sequence of the holotype. Sample NVG-18115B03, GenBank OR837741, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGTACAGAATTAGGTAACCCTGGATCTTTAATTGGGAATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCTGATATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGAATATTACCCCCCTCACTAACATTATTAATCTCAAGAAGAATTGTAGAAAACGGTGCAGGAACAGGTTGAACTGTTTACCCCCCCTTATCATCTAATATTGC TCATCAAGGATCTTCAGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATCATTAATATACGAATTAAAAACTTAATG TTTGATCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCTTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAACACTT CATTTTTTGATCCAGCAGGGGGAGGAGATCCAATTTTATATCAACACTTATTC</p><p>Type material. Holotype: ♂ deposited the National Museum of Natural History, Washington, DC, USA</p><p>Taxco, IX-14-82 | 1850–1900 m], [J. A. Powell | J. A. Chemsak | collectors], [ Poanes zabulon | (Boisduval &amp; Le Conte) | ♂ | det. J. M. Burns 1992], [DNA sample ID: | NVG-18115B03 | c/o Nick V. Grishin], [USNMENT | {QR Code} | 01531551], and one red [HOLOTYPE ♂ | Lon co | Grishin]. Paratypes: 8♂♂: Mexico: 1♂ Tamaulipas, 11 km NW Gomez Farias, 6 km W Rancho Cielo, el. 5200- 5500 ft, 9-Jul-1965, genitalia vial NVG231115-03 (NVG-22056F05) [TMMC]; 1♂ Veracruz, 10 km W Coscomatepec, el. 1800 m, 12-Aug-1987, Brown &amp; Powell leg, genitalia vial J. M. Burns X-2953 (NVG-19068D12, USNMENT 01559668) [USNM]; 1♂ Puebla, 6 mi N Chapulco, el. 7000', 4-Oct-1975, J. Powell, T . Eichlin &amp; T . Friedlander leg. (NVG-18115B02, USNMENT 01531550) [USNM]; Oaxaca, 5- 10 mi N of Oaxaca, el. 6000-7000 ft, J. Kemner leg.: 1♂ 22-Aug-1992 (NVG-18115B04, USNMENT 01531552) [USNM] and 1♂ 30-Aug-1989, genitalia vial NVG231115-02 (NVG-22056E08) [TMMC]; 1♂ Chiapas, 12 km S of Las Casas, 26-28-Mar-1959, T . C. Emmel leg. (NVG-18115B05, USNMENT 01531553) [USNM]; 1♂ El Salvador, 2 mi down from Cerro Verde summit, 20-Aug-1972, C. F. &amp; S. Hevel leg. (NVG-18115B06, USNMENT 01531554) [USNM]; 1♂ Costa Rica, Puntarenas Prov., Monteverde, el. 1300 m, 18-May-1985, J. A. Chemsak leg. (NVG-18115B07, USNMENT 01531555) [USNM] .</p><p>Type locality. Mexico: Guerrero, 5–7 km NW of Taxco.</p><p>Etymology. The name is the last syllable of the country name of the type locality: [Mexi] co. The name is a noun in apposition.</p><p>Distribution. Mexico to Costa Rica.</p></div>	https://treatment.plazi.org/id/D20187A3025C8C11FE81FCC3FDC3FCA7	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302408C16FDB2FCC3FC10FF56.text	D20187A302408C16FDB2FCC3FC10FF56.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Lon Grishin 2019	<div><p>Lon ma Grishin, new species</p><p>http://zoobank.org/ 74F97D16-BF2C-414A-B090-BEDAEED53343 (Figs. 50c, 51 part)</p><p>Definition and diagnosis. Genomic trees of specimens identified as Lon zabulon (Boisduval &amp; Le Conte, [1837]) (type locality in North America, possibly USA: Georgia) reveal their partitioning into three clades: from the USA, which is L. zabulon in accord with its phenotype and the type locality, and two others that do not have names (Fig. 51). One of these clades (Fig. 51 blue) is described as a new species above. The second clade consists of specimens from Panama (Fig. 51 red) and differs from L. zabulon by Fst / Gmin /COI barcode of 0.50/0.009/2.3% (15 bp) and from L. co sp. n. by 0.47/0.008/3.2% (21 bp), thus representing a new species. This species differs from L. zabulon in being brighter colored and more orange; the orange-yellow patch on dorsal hindwing smaller, more like a patch than the entire hindwing being orange with brown borders, brown border wider; beneath brown spots larger; and from L. co sp. n. in more extensive orange-yellow areas on the forewing, e.g., submarginal and subapical forewing spots larger, on ventral side subapical triplet of spots more orange, like submarginal doublet, not yellower than it; and the absence of pale ray along dorsal hindwing 1b vein that is usually expressed in L. co sp. n. and L. zabulon . Definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly525.115.3:G328A, aly 2336.10.2:C108T, aly 2336.10.2:G116A, aly923. 19.4:T246G, aly923.19.4:C393T and in COI barcode: T79C, T169C, T206C, A349G, A577G.</p><p>Barcode sequence of the holotype. Sample NVG-18115B09, GenBank OR837742, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGTACAGAATTAGGCAATCCTGGATCTTTAATCGGAGATGATCAAATTTATAACACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTACCACTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGTTTTTGAATATTACCCCCTTCACTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTACCCCCCCTTGTCATCTAATATTGC TCATCAAGGATCCTCAGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTAATG TTTGACCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCTTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATGTTACTTACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACACTTATTC</p><p>Type material. Holotype: ♂ deposited in the National Museum of Natural History, Washington, DC, USA [USNM], illustrated in Fig. 50c, bears four printed (date handwritten) labels: three white [PANAMA: Chiriqui | Volcan Baru 1800 m | 5 Dec.'76 | leg. S. S. Nicolay], [DNA sample ID: | NVG-18115B09 | c/o Nick V. Grishin], [USNMENT | {QR Code} | 01531557], and one red [HOLOTYPE ♂ | Lon ma | Grishin]. Paratype: 1♂ Panama, Chiriqui, Volcan Baru, el. 1759 m, GPS 8.683, −82.500, 14- Feb-1981, G. B. Small leg. (NVG-18115B08, USNMENT 01531556) [USNM].</p><p>Type locality. Panama: Chiriquí, Volcán Barú, elevation ca. 1800 m .</p><p>a noun in apposition.</p><p>Distribution. Currently known only from Chiriquí, Panama.</p></div>	https://treatment.plazi.org/id/D20187A302408C16FDB2FCC3FC10FF56	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302478C14FED0FEB3FD47FEAE.text	D20187A302478C14FED0FEB3FD47FEAE.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cobalus vitellina Herrich-Schaffer 1869	<div><p>Neotype designation for Cobalus vitellina Herrich-Schäffer, 1869</p><p>Cobalus vitellina Herrich-Schäffer, 1869 was described within the identification key from an unstated number of specimens without locality data (Herrich-Schäffer 1869). The description was rather general and can apply to several species. Our translation from German of relevant segments assembled from the Herrich-Schäffer key is: “forewing cell 3 with a pale spot before its middle, discal cell unmarked; hindwing above with three yellow spots in cells 3–5, on the underside with a continuous yellow band.” Primary types for several names proposed in the same work are curated in MFNB. These types came from the Herrich-Schäffer collection (label “Coll. H.—Sch.”) through the Staudinger collection (label “Coll. Staudinger”) and frequently bear identification labels in Herrich-Schäffer handwriting. To confidently infer the taxonomic identity of C. vitellina, we searched for such specimens in MFNB that agreed with the original description. We were not able to find syntypes of C. vitellina and turned to additional resources, such as publications and specimens collected around the time of C. vitellina description identified as this species or agreeing with the original description.</p><p>According to Godman (1907), Plötz illustrated “nearly all” species described by Herrich-Schäffer. While these drawings are not located to this day, Godman found specimens in his collection that, in his opinion, matched each drawing closely and obtained drawing copies of species he could not identify (1907). While there is no certainty that Plötz illustrated Herrich-Schäffer syntypes and not some other specimens determined by him or by Herrich-Schäffer to be these species, we use Plötz’s (1883) description of C. vitellina, which he placed in the genus Hesperia Fabricius, 1793 (type species Papilio comma Linnaeus, 1758), to learn more about this taxon. Plötz’s description of his drawings (rather than actual specimens) is more detailed than Herrich-Schäffer’s and gives “ Mexico ” as the locality. We translate the description from German as: “Ventral side red-brown, forewing with basal half black, hindwing infused with rust-red, past the middle with a distorted rust-yellow band, which in cell 1c projects a ray towards the fringe. Dorsal side brown, forewing with deep red-yellow spots in cells 1–3 and 6–8; a small dot in cell 4. Hindwing with 3 yellow spots in cells 3–5 and yellow fringes. Antenna half as long as the forewing.” Both this description and Godman’s (1907) assessment, which noted that Plötz illustrated both a male and female from Mexico, agree with H. vitellina being either conspecific with or closely related to Lon melane (W. H. Edwards, 1869) (type locality in USA: California). Moreover, Draudt (1921 –1924) frequently used (inferior) copies of Plötz’s drawings as illustrations (Nakahara et al. 2022), and his figures of melane (plate 182e) might be copied from Plötz’s H. vitellina, which Draudt synonymized with L. melane . The dorsal side shows a female, which is either an atypical specimen or not this species (instead reminding of Buzyges rolla (Mabille, 1883)) because the spots in cells M 3 -CuA 1 and CuA 1 -CuA 2 are nearly aligned with each other (in Lon species, these two spots do not overlap in most specimens), unless this is an imperfection of the reproduction from the original. The ventral side is of a male and is identifiable as L. melane or its close relative.</p><p>Furthermore, we found two specimens of interest in MFNB. The first specimen (NVG-21116G04), from the Möschler collection collected in Mexico in 1876 and identified by Möschler as “ vitellina ”, agrees with all characters of this taxon presented above, except that the three spots on the dorsal hindwing are barely visible. This specimen cannot be a syntype because it was collected after the description of C. vitellina . The second specimen (NVG-22091C05) is from Herrich-Schäffer’s collection, also from Mexico, and bears the identification label “marmorosa HS” in Herrich-Schäffer’s handwriting. This specimen is one of those Godman (1900) mentioned within his treatment of “ Atrytone melane ” and identified as such. It is probably not a syntype of C. vitellina either because it possesses four (or even five), and not three, as per the original description, yellow spots on the dorsal hindwing. This is a boldly patterned specimen with a very wide ventral hindwing orange-yellow band occupying nearly a third of the wing area, and it is possible that Herrich-Schäffer viewed it as a new species that he planned to call “marmorosa”, a name that was never published. Nevertheless, both specimens (NVG-21116G04 and NVG-22091C05) fall within the current concept of “ Paratrytone melane vitellina ” as outlined by Evans (1955) and have not been questioned since (Mielke 2005).</p><p>Not finding syntypes, we proceeded with the neotype designation because there was an exceptional need to clarify both the taxonomic identity and the type locality of C. vitellina . Although the name has been consistently applied to the Mexican subspecies of L. melane, the potential for destabilization of nomenclature arises due to the existence of additional species in this group in Mexico and Central America (see below) unless the name C. vitellina is objectively defined by the neotype that also provides details about the type locality. A number of Hesperiidae species from Mexico described in the second half of the 19 th century were likely based on specimens from Oaxaca, possibly collected by Deppe in 1824–1829. Therefore, we selected a neotype from Oaxaca. Hereby, N.V. G. designates a specimen in USNM illustrated in Fig. 53 (DNA sample NVG-18115F05) as the neotype of Cobalus vitellina Herrich-Schäffer, 1869 . This neotype corroborates the current application of the name for a relative of L. melane from Mexico, as stated by Plötz (1883) and Godman (1907), supported by Evans (1955), and followed since in all literature (Mielke 2005).</p><p>This neotype satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of Cobalus vitellina Herrich-Schäffer, 1869, which is necessary because additional species are present among its close relatives, and to define the type locality that was not stated in the original description; 75.3.2. The characters to differentiate this taxon from others were given in the original description (Herrich-Schäffer 1869), further elaborated by Plötz (1883). We regard them as follows: forewing brown with orange yellow spots in cells R 3 -R 4, R 4 -R 5, R 5 -M 1, M 3 -CuA 1, CuA 1 -CuA 2, and CuA 2 -1A+2A, and a dot in cell M 2 -M 3, discal cell unmarked; forewing beneath with nearly black basal half; hindwing above brown with three yellow spots in cells M 1 -M 2, M 2 -M 3, and M 3 - CuA 1; hindwing beneath rust-colored with a continuous orange-yellow band; antenna about half of the forewing in length; 75.3.3. The neotype specimen is a male bearing three labels: [MEXICO: OAXACA | c. 3 mi. E La | Trinidad, 8500 ft | 3-VIII-1992 | J. Kemner], [DNA sample ID: | NVG-18115F05 | c/o Nick V. Grishin], [USNMENT | {QR Code} | 01531599] and illustrated in Fig. 53; the neotype has a tear along SC vein from costa on the right forewing; 75.3.4. We carefully searched for syntypes of C. vitellina in the MFNB collection (see above) because most of the Herrich-Schäffer Hesperiidae types are in this collection, and a study by Häuser et al. (2003) did not locate the syntypes in Stuttgart. We also checked the ANSP collection, where several Herrich-Schäffer types of Caribbean taxa are curated. We failed to find syntypes of C. vitellina among Hesperiidae holdings in these collections and, therefore, believe that they were lost; 75.3.5. The neotype closely agrees with the original description of C. vitellina in all characters, as evidenced by comparing the neotype illustrated in Fig. 53 with the characters for this taxon given in the original description (Herrich-Schäffer 1869) and listed above (75.3.2.); 75.3.6. The neotype is from Mexico: Oaxaca, ca. 3 mi E of La Trinidad, 8500 ft, and the type locality was not specified in the original description but was stated as “ Mexico ” by Plötz (1883); 75.3.7. The neotype is in</p><p>C. vitellina neotype, sample NVG-18115F05, GenBank OR837743, 658 base pairs, is: AACCTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCCTTAAGATTACTAATTCGTACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAACACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATCGGAGGATTTGGAAATTGATTAGTCCCATTAATATTAGGTGCCCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGTTTTTGAATATTACCCCCCTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTACCCCCCCTTATCATCTAATATTGC ACACCAAGGCTCTTCTGTTGATTTAGCAATTTTTTCACTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAAAAATTTAATG TTTGATCAAATACCTTTATTCGTATGATCTGTAGGTATTACAGCCTTATTATTACTTTTATCTTTGCCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT</p></div>	https://treatment.plazi.org/id/D20187A302478C14FED0FEB3FD47FEAE	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302458C14FED1FC60FB41FAA3.text	D20187A302458C14FED1FC60FB41FAA3.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Lon vitellina (Herrich-Schaffer 1869)	<div><p>Lon vitellina (Herrich-Schäffer, 1869) and Lon poa (Evans, 1955) are species distinct from Lon melane (W. H. Edwards, 1869)</p><p>Genomic trees reveal that Cobalus vitellina Herrich-Schäffer, 1869 (type locality in Mexico: Oaxaca) and Paratrytone melane poa Evans, 1955 (type locality Costa Rica: Mount Poás), currently treated as subspecies of Lon melane (W. H. Edwards, 1869) (type locality in USA: California, likely San Francisco Bay area), are genetically differentiated from it at the species level (Fig. 54), e.g., Fst / Gmin /COI barcode difference from L. melane of 0.57/0.002/3.2% (21 bp) for C. vitellina and 0.66/0.001/2.3% (15 bp) for P. melane poa . Therefore, we propose that Lon vitellina (Herrich-Schäffer, 1869), stat. rest. and Lon poa (Evans, 1955), stat. nov. are species distinct from Lon melane (W. H. Edwards, 1869) .</p></div>	https://treatment.plazi.org/id/D20187A302458C14FED1FC60FB41FAA3	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302458C15FE0BFAF8FBC8FB06.text	D20187A302458C15FE0BFAF8FBC8FB06.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Lon melane (W. H. Edwards 1869) Edw.	<div><p>Lon melane sur Grishin, new subspecies</p><p>http://zoobank.org/ A41D2EC4-85A8-4728-AD8E-233BF09A90DB</p><p>(Figs. 54 part, 55)</p><p>Definition and diagnosis. Genomic sequencing of the two specimens from Baja California Sur, Mexico, identified as a possible subspecies or a distinct geographical segregate of “ Paratrytone melane ” in previous works (Powell 1958; MacNeill 1962; Brown et al. 1992) reveals that they are indeed closely related to Lon melane (W. H. Edwards, 1869) (type locality in USA: California, likely San Francisco Bay area) (Fig. 54): e.g., their COI barcodes differ by 0.3–0.6% (2–4 bp), and, therefore, we consider them to be conspecific with it. However, the BCS specimens differ from the nominotypical L. melane in reduced fulvous overscaling at wing bases above, smaller orange spots on the forewing, more diffuse and brownish instead of orange dorsal hindwing spots, and weakly spotted more uniformly colored ventral hindwing. Therefore, they represent a distinct subspecies, which is new. A more detailed description of this subspecies was given by MacNeill (1962: 110–111), who called it “ Paratrytone melane subsp.” without proposing a formal name. Definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly770.31.1:A393C, aly3721.1.4:G45A, aly93.14. 4:C408T, aly322.23.3:A87G, aly65.5.1:T199C and in COI barcode: T56C, T379A, T418C, T530C, C646C.</p><p>Barcode sequence of the holotype. Sample NVG-22101H10, GenBank OR837744, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCCTTAAGACTATTAATTCGTACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCATTAATATTAGGTGCCCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGTTTTTGAATACTACCCCCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTACCCCCCTTTATCATCTAATATTGC TCATCAAGGCTCTTCAGTTGATTTAGCAATCTTTTCACTTCATTTAGCTGGAATCTCATCTATTTTAGGAGCTATTAACTTTATTACAACAATTATCAATATACGAATTAAAAATTTAATG TTTGATCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCCCTATTATTACTTTTATCTTTACCCGTTTTAGCTGGAGCTATTACTATATTACTTACCGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the California Academy of Sciences, San Francisco, CA, USA [CAS], illustrated in Fig. 55, bears eight labels: seven white [La Laguna, | Sierra Laguna, | L.Cal.X-14- 41], [ melane Edw. | Det. by | F H Rindge], [Ross &amp; Bohart | Collectors], [♂], [melane subspecies], [DNA sample ID: | NVG-22101H10 | c/o Nick V. Grishin], [{QR Code} CASENT | 8566940], and one red [HOLOTYPE ♂ | Lon melane | sur Grishin]. Paratype: 1♂ same data as the holotype (NVG-22101H09, CASENT 8566939).</p><p>Type locality. Mexico: Baja California Sur, Sierra de La Laguna .</p><p>Etymology. The name, a masculine noun in apposition, is the last word in the type locality state name, also meaning that this is the southernmost subspecies of L. melane .</p><p>Distribution. Mountains of the Cape region in Baja California Sur, Mexico.</p></div>	https://treatment.plazi.org/id/D20187A302458C15FE0BFAF8FBC8FB06	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302448C1AFDBBFB66FBF0FB32.text	D20187A302448C1AFDBBFB66FBF0FB32.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Lon chia Zhang & Cong & Shen & Song & Grishin 2023	<div><p>Lon chia Grishin, new species</p><p>http://zoobank.org/ E4498D7B-4A5E-4411-9CB0-E336AA04311F</p><p>(Figs. 54 part, 56)</p><p>Definition and diagnosis. The genomic tree reveals that specimens identified as Lon poa (Evans, 1955) (type locality Costa Rica: Mount Poás), stat. nov. partition into two clades (Fig. 54). One clade includes specimens from Costa Rica and Panama, being the true L. poa by locality and phenotype. The other clade is genetically differentiated from the first one with Fst/Gmin/COI barcode difference of 0.41/0.004/0.9% (6 bp) and represents a new species. This species keys to “ Paratrytone melane poa ” M.23.1(c) in Evans (1955) and is distinguished from the true L. poa by less extensive yellow overscaling on the ventral side of wings, in particular, on the hindwing; this overscaling is whiter, and the ground color in redder and browner than yellower. As a result, there is less contrast between the darker inner half and subapical half of the ventral forewing, which is paler in the apical half and contrasting dark brown towards the inner margin in L. poa . Definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly3177.11.6:A36C, aly3177.11.6:A39G, aly128.24.1: C189T, aly128.24.1:A235C, aly318.14.6:G672A and in COI barcode: T4C, T346C, T505C, A550A, 586T. Barcode sequence of the holotype. Sample NVG-22105H05, GenBank OR837745, 658 base pairs: AACCTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCCTTAAGATTATTAATTCGTACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAACACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATCGGAGGATTTGGAAATTGATTAGTCCCATTAATATTAGGTGCCCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGTTTTTGAATATTACCCCCCTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTACCCCCCCTTATCATCTAATATTGC ACACCAAGGCTCTTCTGTTGATTTAGCAATTTTTTCACTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAAAAATTTAATG TTTGATCAAATACCTTTATTCGTATGATCTGTAGGTATTACAGCCTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the California Academy of Sciences, San Francisco, CA, USA [CAS], illustrated in Fig. 56, bears five labels, the first two handwritten, others printed: four white [Rancho Belen, Chis. | Mex. IV-17-69 | Robert Wind], [ P. m. poa], [DNA sample ID: | NVG-22105H05 | c/o Nick V. Grishin], [{QR Code} CASENT | 8568431], and one red [HOLOTYPE ♂ | Lon chia | Grishin]. Paratypes: 5♂♂ 1♀: Mexico, Chiapas: 1♂ Comitan, Laguna Chamula, el. 7100 ft, 13-May-1987, C. J. Durden leg. (NVG-22056D01) [TMMC]; San Cristobal, La Almolonga, ca. 7500 ft: 1♂ 3-May-1988, J. Kemner leg. (NVG-18115F06, USNMEND 01531600) [USNM]; 1♂ 9-Jul-1988, C. J. Durden leg. (NVG-20062F09) [TMMC]; 1♂ 5-Jul-1992, J. Kemner &amp; A. Vasquez leg. (NVG-18115F08) [USNM]; 1♂ Guatemala, Quiche department, above Chichicastenango, 11-Jan-1990, C. J. Durden leg. (NVG-22056C06) [TMMC]; and 1♀ El Salvador, 2 mi down from Cerro Verde summit, 20-Aug-1972, G. F. &amp; S. Hevel leg. (NVG-18115F09, USNMENT 01531603) [USNM].</p><p>Type locality. Mexico: Chiapas, ca. 20 km S of San Cristóbal, Rancho Belén.</p><p>Etymology. Like poa formed from “Mt. Poas”, the name chia is formed from Chiapas, for the type locality of this species. The name is a noun in apposition.</p><p>Distribution. Confirmed from Mexico: Chiapas, Guatemala, and El Salvador.</p></div>	https://treatment.plazi.org/id/D20187A302448C1AFDBBFB66FBF0FB32	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3024B8C1BFE87FAB8FA4FFBA2.text	D20187A3024B8C1BFE87FAB8FA4FFBA2.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Atrytonopsis edwardsi W. Barnes & McDunnough 1916	<div><p>Atrytonopsis edwardsi W. Barnes &amp; McDunnough, 1916</p><p>Lerodea? rupilius Schaus, 1913 (type locality given as “Guapiles” [Costa Rica] in the original description) was regarded as nomen dubium by Burns (1983), who concluded that its syntype in USNM was “phony”: it differed in some aspects from the original illustration in Schaus (1913) and was labeled from “Guadljara the original description and bears labels in a style typical of all syntypes by Schaus. One of them is the identification label in his handwriting with this species’ name and the word “type.” It is difficult for us to imagine that this specimen is not a true syntype, provided that all other species Schaus proposed based on USNM material have extant syntypes in the collection. However, illustrations of specimens were not known to be particularly accurate, and we hypothesize that there was a mistake in stating the locality of a syntype in the original description: Guadljara was erroneously replaced with Guapiles in the publication (Schaus 1913), maybe because both words start with “Gua”. Therefore, we regard this female “type,” possibly the only specimen Schaus based his description of L. rupilius on, as a true syntype. To stabilize nomenclature, N.V.G. hereby designates this specimen in the USNM collection bearing the following four labels, 3 rd red and others white: [Guadljara | Mex], [ Lerodea ? | rupilius | type Schs], [Type | No. 16817 | U.S. N.M.], [GENITALIA NO. | X-1060 | J. M. Burns 1981] as the lectotype of Lerodea? rupilius Schaus, 1913 .</p><p>Morphologically, Burns (1983) identified the lectotype of L. rupilius as Atrytonopsis edwardsi W. Barnes &amp; McDunnough, 1916 (type locality in USA: Arizona, Pima Co.), therefore, L. rupilius is not a junior subjective synonym of Atrytonopsis ovinia zaovinia Dyar, 1913 (type locality in Mexico: Puebla)—currently a junior subjective synonym of Atrytonopsis ovinia (Hewitson, 1866), (type locality in Nicaragua)—as treated by Evans (1955). Genomic analysis confirms this assessment and places the lectotype as sister to another specimen from Mexico: Jalisco (Fig. 57), thus also confirming the type locality as Mexico: Jalisco, Guadalajara. The two specimens from Jalisco (Fig. 57 red) are genetically differentiated from A. edwardsi specimens collected in the USA: Arizona and Texas and Mexico: Sonora (Fig. 57 blue), forming a separate clade. Due to this genetic differentiation, we propose that L. rupilius is a subspecies of Atrytonopsis edwardsi W. Barnes &amp; McDunnough, 1916: Atrytonopsis edwardsi rupilius (Schaus, 1913), comb. nov., stat. nov. Despite a large gap in their distributions, we note that neither COI barcodes nor the whole mitochondrial genomes differentiate these subspecies, and we also see mitochondrial introgression from A. ovinia to A. edwardsi (Fig. 57b, red and violet within the blue clade).</p></div>	https://treatment.plazi.org/id/D20187A3024B8C1BFE87FAB8FA4FFBA2	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3024A8C1BFE0BFBF6FD02FAE7.text	D20187A3024A8C1BFE0BFBF6FD02FAE7.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Vidius tanna (de Jong 1983) Zhang & Cong & Shen & Song & Grishin 2023	<div><p>Vidius tanna (de Jong, 1983) comb. nov.</p><p>Genomic sequencing of the holotype of Cobalopsis tanna de Jong, 1983 (type locality in Suriname), currently kept in its original genus, reveals that it is not monophyletic with Cobalopsis Godman, 1900 (type species Pamphila edda Mabille, 1891, which is a junior subjective synonym of Hesperia autumna Plötz, 1882) and instead originates within Vidius Evans, 1955 (type species Narga vidius Mabille, 1891) (Fig. 58). Therefore, we transfer this species from Cobalopsis to Vidius forming a new combination Vidius tanna (de Jong, 1983), comb. nov.</p></div>	https://treatment.plazi.org/id/D20187A3024A8C1BFE0BFBF6FD02FAE7	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
