taxonID	type	description	language	source
D20187A302748C25FDB4FFD8FD29FB02.taxon	type_taxon	Type species. Papilio rapae Linnaeus, 1758. Definition. Genomic phylogeny of the genus Pieris Schrank, 1801 (type species Papilio brassicae Linnaeus, 1758) reveals several prominent clades that could be regarded as subgenera, including the nominotypical (Fig. 3 violet) and Artogeia Verity, 1947 (type species Papilio napi Linnaeus, 1758) (Fig. 3 blue). Although Sinopieris H. Huang, 1995 (type species Sinopieris gongaensis H. Huang, 1995) (Fig. 3 red) is not supported by a very prominent branch, this group of species is confidently monophyletic, originates around the same time as other subgenera and is phenotypically distinct. The remaining fourth clade (Fig. 3 green) is prominent and cannot be confidently included in other subgenera: it is sister to the subgenus Pieris in the genomic tree, but only with 88 % support (not above 95 %). Therefore, this green clade represents the fourth subgenus, and it does not have a name. This new subgenus constitutes the P. rapae group of Robbins and Henson (1986), who described and illustrated diagnostic characters for it. In brief, species in the new subgenus are distinguished from the nominotypical subgenus by shorter (less than half the size) and onion-shaped, rather than elongated, androconia and from Artogeia and Sinopieris by the lack of posterior process on signum (Robbins and Henson 1986) and, additionally, by the lack of overscaling along ventral hindwing veins. In DNA, a combination of the following characters is diagnostic in the nuclear genome: pra 6360.8. e 1: T 87 A, pra 590.15. e 1: A 181 C, pra 82.57. e 2: G 168 T, pra 82.57. e 2: T 177 C, pra 283.114. e 1: A 531 T and in COI barcode: T 163 A, A 205 T, T 421 T, G 512 G, C 533 C, T 535 T, T 589 C, C 641 C.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302748C25FDB4FFD8FD29FB02.taxon	etymology	Etymology. The name is a fusion of the type species name with its genus name: Rap [ae] + [Pier] is. The name is a feminine noun in the nominative singular. Species included. The type species (i. e., Papilio rapae Linnaeus, 1758), Papilio canidia Linnaeus, 1768, Pieris krueperi Staudinger, 1860, Pontia mannii J. Mayer, 1851, and Pieris tadjika Grum-Grshimaïlo, 1888 (Robbins and Henson 1986), including their closest relatives sometimes regarded as distinct species. Parent taxon. Genus Pieris Schrank, 1801.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027B8C2BFF46FF11FB7AFF4E.taxon	description	We suspect that the absence of wing patterns in Sinerebia atramentaria hindered its taxonomic classification until it was revealed by genomic sequencing. Finally, to define the taxonomic identity of this species objectively, N. V. G. hereby designates a syntype in the MTD collection, a male with the following five printed labels, the 4 th yellow, and others white: [Kansu sept. occ. | Hsining | Nanshan mont. | Tatung | 3500 m. Juli], [Staudinger | Ankauf 1948], [711], [atramentaria O. Bang-Haas, 1927 | Grishin] as the lectotype of Erebia atramentaria Bang-Haas, 1927. The lectotype has noticeable areas on wings with scales partially rubbed off and a small nick by the apex of the left forewing.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027A8C29FE0CFC2AFCB4FF7B.taxon	description	(Figs. 6 part, 7)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027A8C29FE0CFC2AFCB4FF7B.taxon	diagnosis	Definition and diagnosis. Genomic sequencing of specimens identified as Chlosyne endeis (Godman & Salvin, 1894) (type locality in Mexico: Nayarit) reveals that they are either not monophyletic (in nuclear trees) or prominently separated into two clades (in the mitochondrial genome) (Fig. 6). Fst / COI barcode difference between the specimens in two clades are 0.38 / 1.5 % (10 bp), typical for closely related but distinct species of Chlosyne Butler, 1870. Therefore, the specimens we sequenced belong to one of the two distinct species. We identify specimens from Nayarit, Mexico, the state with the type locality of C. endeis as that species. Specimens from south Texas (USA) and eastern Mexico are not C. endeis and belong to a different species. This species was at times regarded as a subspecies of C. endeis under the name “ pardelina, ” which was attributed either to Higgins (Lamas 2004) or to Scott (Pelham 2008). However, neither Higgins (1960) nor Scott (1986) made the name available. Higgins proposed “ form pardelina forma nov. ” for “ male specimens of endeis …, in which the ground-colour is yellow ” (Higgins 1960). However, according to Articles 45.6.1 and 45.6.4.1 of the ICZN Code (ICZN [International Commission on Zoological Nomenclature] 1999), this name is infrasubspecific because it was applied to an infrasubspecific entity and not “ adopted ” before 1985, and therefore is unavailable. The glossary of the ICZN Code defines “ infrasubspecific entity ” as “ … Specimen (s) within a species differing from other specimens in consequence of intrapopulation variability (e. g., opposite sexes, …, ” and Higgins applied the name to male specimens. Scott did not establish this name either because he merely applied it (not even referencing Higgins) to the subspecies of C. endeis “ in the U. S. ” without description, definition, or bibliographic reference to such (fails Art. 13.1). Therefore, this species lacks an available name, and is new. This new species is generally similar to C. endeis in having brown wings with yellow or white spots, some in discal bands separated by veins, and two patches of submarginal red spots (sometimes vestigial) distad of the yellow discal band on the dorsal hindwing, by the apex and tornus. The new species differs from C. endeis in having a yellow to orange rather than a white discal band of dorsal hindwing (and frequently on forewing) and typically larger patches of red hindwing spots. Due to phenotypic variability, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: hm 2012952 - RA. 1: A 156 G, hm 2012952 - RA. 1: A 543 T, hm 2010701 - RA. 4: C 66 T, hm 2018077 - RA. 9: G 69 C, hm 2006719 - RA. 4: C 78 T and in COI barcode: A 286 C, C 451 T, 562 T, 574 C, A 625 G. Barcode sequence of the holotype. Sample NVG- 17117 C 06, GenBank OR 837724, 658 base pairs: TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGACTTTTAATTCGAACAGAATTAGGAAATCCAGGTTCATTAATTGGAGATGATCAAATTTATAATACA ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTCCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAA TAAATAATATAAGATTTTGATTATTACCCCCCTCATTAATTCTCTTAATTTCCAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGC TCATAGAGGATCTTCTGTTGATTTAGCAATTTTTTCATTACATCTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACTACAATCATTAATATACGAATTAATAATATATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCCCTTTTACTACTTTTATCTTTACCTGTATTAGCTGGAGCTATTACCATACTTCTAACTGATCGAAATATTAATACAT CATTTTTTGATCCTGCAGGGGGAGGAGATCCAATCTTATACCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027A8C29FE0CFC2AFCB4FF7B.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Texas A & M University Insect Collection, College Station, TX, USA [TAMU], illustrated in Fig. 7, bears six labels: five white [TEXAS: | DUVAL COUNTY | Texas Hwy 16 ca | 15 mi (24 km) S | of Freer at Parrilla Creek], [ex larva | (had larval diapause) | 11 Sep 1980 | Roy O. Kendall | and C. A. Kendall], [Larval foodplant: | ACANTHACEAE | Carlowrightia | parviflora (Buckl. | Wasshausen (foliage)], [NYMPHALIDAE: | Chlosyne endeis | pardelina | ♂ Higgins, 1960 | det. Roy O. Kendall | [M. & B. No. 601. b ]], [DNA sample ID: | NVG- 17117 C 06 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Chlosyne pardelina | Grishin]. Its pupal case and the last instar caterpillar exuvium are in a gelatine capsule pinned under the specimen. The date given on the label refers to eclosion. Paratypes: 2 ♀♀: 1 ♀ the same data as the holotype, but eclosed on 13 - Sep- 1980 (NVG- 17117 C 05) and 1 ♀ Mexico: San Luis Potosí, Rte 80, 2 – 7 mi NW Ciudad del Maíz, 16 - Jul- 1988, D. Mullins leg. (NVG- 19086 A 10, USNMENT 01314130) [USNM]. Type locality. USA: Texas, Duval Co., SH 16 ca. 15 mi south of Freer at Parrilla Creek, GPS 27.6478, − 98.6572. pardelina refers to any small, spotted, or mottled bird, and it fits the general appearance of this species. The name is a feminine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027A8C29FE0CFC2AFCB4FF7B.taxon	distribution	Distribution. South Texas and northeastern Mexico.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302788C2EFE50FC2DFB6FFC4F.taxon	description	(Figs. 6 part, 8)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302788C2EFE50FC2DFB6FFC4F.taxon	diagnosis	Definition and diagnosis. Before this work, western populations of Chlosyne definita (E. Aaron, 1885) (type locality in USA: Texas, Nueces Co.), including those in northwestern Mexican states of Sonora and Chihuahua have been placed within the subspecies Chlosyne definita anastasia (Hemming, 1934) (type locality Mexico: Durango, Durango City) due to their phenotypic similarity in having less extensive dark markings and narrower white band and spots on wings venter. Genomic trees reveal that C. d. anastasia is not monophyletic, and the populations near its type locality are genetically differentiated at the species level (i. e., C. anastasia stat. rest., see above) (Fig. 6), but more northern populations differ from them by 3.3 % (22 bp) in COI barcode and are closer related to the nominotypical C. definita (COI barcode difference of 0.6 % 4 bp). Therefore, we regard these northwestern Mexico populations as conspecific with C. definita, but due to their phenotypic and genetic differences propose that they constitute a distinct subspecies. This new subspecies is phenotypically more similar to C. anastasia stat. rest. and differs from it in the following characters: the central white band on the ventral hindwing is less broad but broader than in the nominotypical subspecies; black markings are more extensive but less expressed than in the nominotypical subspecies, e. g., the basal white band on the ventral hindwing is typically cut through (or even cut short) by black overscaling around vein 1 A + 2 A. Due to phenotypic variability, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: hm 2010867 - RA. 6: C 66 T, hm 2010867 - RA. 6: G 87 A, hm 2003966 - RA. 6: T 1521 C, hm 200 3966 - RA. 6: C 4239 T, hm 2014195 - RA. 2: A 709 G and in COI barcode: A 40 G, 169 T, A 205 T, T 283 C, T 475 T. Barcode sequence of the holotype. Sample NVG- 22088 C 12, GenBank OR 837725, 658 base pairs: TACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTGGGAACATCTTTAAGACTTTTAATTCGAACAGAATTAGGAAATCCAGGTTCATTAATTGGAGATGATCAAATTTATAATACA ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAA TAAATAATATAAGATTTTGATTATTACCCCCCTCATTAATCCTATTAATTTCCAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGC TCATAGAGGATCATCTGTTGATTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATCACCACAATCATTAATATACGAGTTAATAATATATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCTCTTTTACTACTTTTATCTTTACCTGTATTAGCTGGAGCAATTACAATACTTCTAACTGATCGAAATATTAATACAT CATTCTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302788C2EFE50FC2DFB6FFC4F.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 8, bears four printed (text in italics handwritten) labels: three white [Chihuahua, Mex. | 19.4 miles E. of | Tomochic Oak-Pine | July 29, 1984. | ca 7000 ' Leg D. Mullins], [J. D. Turner ex | Malcolm Douglas | colln. | MGCL Accession | # 2009 - 26], [DNA sample ID: | NVG- 22088 C 12 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Chlosyne definita | dolosa Grishin]. Paratypes: 2 ♀♀ Mexico, Sonora, 5 mi NW of Yecora, plateau edge, 25 - Jul- 1987, M. Smith leg. (NVG- 22088 D 10) and 28 / 29 - Jul- 1987 (NVG- 22088 D 01) [MGCL]. Type locality. Mexico: Chihuahua, 19.4 mi E of Tomochic, elevation ca. 7000 '.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302788C2EFE50FC2DFB6FFC4F.taxon	etymology	Etymology. In Latin, dolosus means cunning, deceitful, crafty, or sly. The name is given for the deceitful nature of this subspecies, which was hidden behind the name Chlosyne anastasia before it was revealed by genomic sequence comparison. The name is a feminine adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302788C2EFE50FC2DFB6FFC4F.taxon	distribution	Distribution. Northwestern Mexico, recorded from the states of Sonora and Chihuahua.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027F8C2FFE98FBAAFCD4FA1B.taxon	description	A natural hybrid between Chlosyne bollii (W. H. Edwards, [1878]) and Chlosyne chinatiensis (Tinkham, 1944) Sequencing of a suspected hybrid between Chlosyne bollii (W. H. Edwards, [1878]), stat. rest. (type locality USA: Texas, Bexar Co., San Antonio) and Chlosyne chinatiensis (Tinkham, 1944) (type locality in USA: Texas, Presidio Co.), a female NVG- 19072 B 01 collected in USA: Texas, Brewster Co., along FM 2627 25 mi SE of USH 385 on 23 - Mar- 1994 by Steve M. Spomer (Fig. 10) places it in different positions in the three trees (Fig. 9 olive) thus confirming its hybrid origin. In the nuclear genome tree constructed from autosomes (Fig. 9 a), this specimen is sister to C. chinatiensis, suggesting that it has a significant fraction of C. chinatiensis genes. In the Z chromosome tree (Fig. 9 b), this specimen is within C. bollii, suggesting that its Z chromosome, which in females is inherited from the father (in butterflies, ZZ are males and ZW are females), came from C. bollii. In the mitochondrial genome tree (Fig. 9 c), the specimen is placed within C. chinatiensis, suggesting that its mitochondrial DNA, which is inherited from the mother, came from C. chinatiensis. Therefore, we confirm this female as a natural interspecies hybrid and conclude that its father was C. bollii, and its mother was C. chinatiensis.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027D8C2DFE08FCE8FB29FB32.taxon	diagnosis	Definition and diagnosis. Genomic analysis reveals that an orange female from central Panama (Figs. 12, 13 orange) initially identified as an aberration of Erythia aurantiaca (Salvin & Godman, 1868) (type locality in Guatemala) is instead sister to but genetically differentiated from Erythia cheles (Godman & Salvin, 1889) (type locality in Panama: Chiriquí, holotype sequenced as NVG- 21123 B 03) (Fig. 13), e. g., COI barcode difference of 4.4 % (29 bp). We sequenced two specimens of E. cheles (the holotype and another female, NVG- 19036 F 06), and they are genetically close to each other (Fig. 13 blue). However, due to strong genetic differentiation, the orange female represents a distinct species that, according to our investigation, does not have a name. The female of this new species differs from its relatives in the nearly uniform orange coloration of the dorsal side of wings, only with a hint of the brown outer margin, more developed by the apex of the forewing, and is similarly orange, only slightly yellower, on the ventral side, with a thin postdiscal darker orange band on both wings and no other markings. In females of other species, the apex of the dorsal forewing and usually the outer margin are largely brown, and there are at least traces of black submarginal spots on the ventral hindwing. While it remains unclear whether this specimen is an aberration, we are confident that it is a species distinct from both E. cheles and E. aurantiaca due to its prominent genetic differentiation, and, therefore, it is described as a new species. To confidently identify this new species despite the unknown phenotypic variation, we provide a diagnostic combination of DNA characters in the nuclear genome: cne 11073.6.7: T 54 C, cne 3970.3.2: T 111 C, cne 20880. 1.4: A 84 G, cne 10214.9.8: A 66 G, cne 4577.3.8: C 18 T, cne 1935.4.1: C 1113 C (not T), cne 1935.4.1: C 1558 C (not A), cne 84.2.2: C 1860 C (not T), cne 15258.2.1: A 612 A (not T), cne 14561.1.14: C 79 C (not T) and in the COI barcode: T 16 C, 88 C, T 142 C, T 169 C, T 250 C, T 361 C, T 391 A, T 400 C, A 577 G, T 619 C. Barcode sequence of the holotype. Sample NVG- 19036 F 07, GenBank OR 837726, 658 base pairs: AACTTTATATTTTATCTTTGGAATTTGAGCAGGAATAGTAGGAACATCATTAAGACTATTAATTCGAATAGAATTAGGAATTTCAGGCTCTTTTATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCCATTATAATCGGAGGATTTGGAAATTGACTAGTCCCCCTAATATTAGGAGCCCCTGATATAGCTTTTCCACGAA TAAATAACATAAGATTTTGATTATTACCCCCCTCATTAATACTTTTAATTTCAAGAAGAATTGTCGAAAACGGAGCAGGAACAGGATGAACTGTGTACCCCCCACTATCATCTAATATCGC TCACAGAGGATCATCAGTTGATTTAGCAATTTTTTCCTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAACTTTATCACAACAATTATTAATATACGAGTAAATAATATAATA TTCGATCAAATATCCCTATTTATCTGAGCTGTTGGTATTACAGCTCTATTACTTTTACTATCATTACCAGTTTTAGCAGGAGCTATTACTATGCTATTAACTGATCGAAATTTAAATACAT CATTTTTTGATCCCGCTGGAGGAGGAGATCCAATTCTTTACCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027D8C2DFE08FCE8FB29FB32.taxon	materials_examined	Type material. Holotype: ♀ deposited in the National Museum of Natural History, Washington, DC, USA [USNM], illustrated in Fig. 12, bears four printed labels: three white [Riodinidae? 3 / 28 / 76 | Las Cruces Trail, CZ], [DNA sample ID: | NVG- 19036 F 07 | c / o Nick V. Grishin], [USNMENT | {QR Code} | 00939912], and one red [HOLOTYPE ♀ | Erythia paracheles | Grishin]. Type locality. Panama: Canal Zone, Las Cruces Trail.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027D8C2DFE08FCE8FB29FB32.taxon	etymology	Etymology. The prefix “ para ” means alongside, near, beyond, or similar to. This new species is sister to E. cheles and is similar to it. The name is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027D8C2DFE08FCE8FB29FB32.taxon	distribution	Distribution. Currently known only from the holotype collected in central Panama.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027C8C32FDF0FB4FFB29F998.taxon	description	(Figs. 13 part, 14)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027C8C32FDF0FB4FFB29F998.taxon	diagnosis	Definition and diagnosis. Genomic phylogeny inferred from all sequenced specimens of Euselasiini Kirby, 1871 (1867) reveals that a specimen from central Panama (Figs. 13 magenta, 14) is sister to the clade of Erythia cheles (Godman & Salvin, 1889) (type locality in Panama: Chiriquí) with Erythia paracheles sp. n. (type locality in Panama: Canal Zone) and therefore represents a species distinct from them (Fig. 13), also being strongly differentiated genetically, e. g., COI barcode difference of 4.9 % (32 bp) from E. cheles and 5.9 % (39 bp) from E. paracheles. These three species form a clade sister to Erythia aurantiaca (Salvin & Godman, 1868) (type locality in Guatemala). Even in wing patterns, the specimen from Panama appears different from the named taxa, and these differences, supported by genetic differentiation, suggest that this specimen belongs to a new species. Males of this new species differ from their relatives in a diffuse boundary between brown framing along wing margins and orange interior on the dorsal side: brown overscaling partially extends into orange areas. The brown / orange boundary is sharper and could even be rather crips in closely related species, or orange areas are more restricted on forewing to the area between the inner margin and discal cell. The costal area of the dorsal hindwing is brown from its base, and the discal cell is largely orange but brown towards the costa; the dorsal hindwing has a brown batch at the apex and a brown margin of decreasing width and disappearing towards the tornus; the submarginal area is browner than the brighter orange discal area from costa to mid-wing. The ventral side of the wings is pearly-pinkish with a posdiscal pale-brown line on all wings (close to a submarginal row of spots on the hindwing) and orange-brown narrow marginal framing. Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne 5785.3.5: A 96 T, cne 7688.1.2: T 150 G, cne 3970. 3.2: G 96 A, cne 254625.2.3: G 270 A, cne 10780.4.1: T 1347 A, cne 4782.4.3: T 282 T (not C), cne 3195.11.14: A 54 A (not G), cne 563.4.3: G 216 G (not A), cne 563.4.3: G 219 G (not A), cne 3970.3.2: T 111 T (not C) and in COI barcode: T 4 C, T 56 T, T 197 T, T 202 C, T 206 T, T 274 C, T 550 C. Barcode sequence of the holotype. Sample NVG- 19036 H 09, GenBank OR 837727, 658 base pairs: AACCTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAATAGAACTAGGAATTTCAGATTCTTTTATTGGAGATGATCAAATTTATAACACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCATTAATATTAGGAGCCCCTGATATAGCTTTTCCACGAA TAAATAATATAAGATTTTGATTATTACCCCCCTCATTAATTCTCTTAATTTCAAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACTGTGTACCCCCCACTATCATCTAATATTGC TCATAGAGGATCATCAGTTGATTTAGCTATTTTCTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAGTAAATAATATAATA TTTGATCAAATATCTCTATTTATTTGAGCTGTAGGAATTACAGCATTATTACTCTTATTATCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATCTAAATACAT CATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTCTTTATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027C8C32FDF0FB4FFB29F998.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Washington, DC, USA [USNM], illustrated in Fig. 14, bears four printed (2 nd and 3 rd lines on the 1 st label handwritten) labels: three white [Panama: Panama | Cerro Campana | 800 m. 17. III. 1973 | G. B. Small], [DNA sample ID: | NVG- 19036 H 09 | c / o Nick V. Grishin], [USNMENT | {QR Code} | 01544858], and one red [HOLOTYPE ♂ | Erythia borrosa | Grishin]. Type locality. Panama: Panama Province, Cerro Campana, elevation 800 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027C8C32FDF0FB4FFB29F998.taxon	etymology	Etymology. In Spanish, borrosa means blurry or fuzzy. The name refers to edges between brown and orange in this species that lack the sharpness of its relatives, and brown gradually dissolves into orange, or orange is overscaled with brown towards the margins. The name is a Latinized feminine adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3027C8C32FDF0FB4FFB29F998.taxon	distribution	Distribution. Currently known only from the holotype collected in central Panama.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302628C33FEF0FD14FB40F9E7.taxon	description	First, N. V. G. hereby designates a syntype in the MFNB collection, a female with the following six printed (but 4 th handwritten) labels, the 1 st red, 4 th greenish-gray, and others white: [Typus], [Süd Peru | Pozuzo | e. c. H. Stichel], [2266], [erinnya | Stich.], [ex coll. | H. STICHEL], and [DNA sample ID: | NVG- 21126 B 12 | c / o Nick V. Grishin] as the lectotype of Mesosemia eumene erinnya Stichel, 1910. The lectotype is a specimen in good condition with half of its right antenna broken off, and some scales rubbed off near the middle of the forewing outer margin. The type locality of Ectosemia erinnya becomes Peru: Pozuzo. According to our genomic analysis, the lectotype is conspecific with the paralectotype (NVG- 21126 C 01) from Ecuador: Archidona (Fig. 15). Second, N. V. G. hereby designates a syntype in the MFNB collection, a male with the following six printed (but 4 th handwritten) labels, the 1 st red, 4 th greenish-gray, and others white: [Typus], [Bolivia La Paz | Farinas | e. c. H. Stichel], [2265], [furia | Stich.], [ex coll. | H. STICHEL], and [DNA sample ID: | NVG- 21126 B 11 | c / o Nick V. Grishin] as the lectotype of Mesosemia eumene furia Stichel, 1910. The lectotype lacks the abdomen, and outer-marginal segments of the right forewing are chipped off from the middle to the tornus. The type locality of M. e. furia becomes Bolivia: La Paz, Farinas.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302618C31FDFEFF7FFBC3FCD4.taxon	diagnosis	Definition and diagnosis. Genomic sequencing of Cremna E. Doubleday, 1847 (type species Papilio actoris Cramer, 1776) reveals a clade consisting of a pair from Bolivia (Fig. 16) distinct from other species in the C. actoris group (Fig. 17): COI barcode difference of 1.8 % (12 bp) with a syntype of Cremna meleagris Hopffer, 1874 (type locality in Peru: Chanchamayo), a junior subjective synonym of Cremna heteroea H. Bates, 1867 (type locality in Brazil: Amazonas), sister to the clade representing the new species. This new species differs from its relatives in smaller size, paler wings (especially beneath), more prominent cream-colored marginal spots above, and boomerang-shaped, narrower on the dorsal side postdiscal (in addition to submarginal) spots on both wings (weak on dorsal forewing in the female). These spots are broader and rounder in other species and are crescent-shaped only in Cremna calitra Hewitson, 1869 (type locality in Ecuador), a species with mostly larger spots on the dorsal side, but smaller spots along the outer wing margins (especially on the hindwing) and on the ventral side. Barcode sequence of the holotype. Sample NVG- 22112 E 04, GenBank OR 939283, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGTTCATCTTTAAGTATTTTAATTCGTATAGAATTAGGAATACCTGGTTCTCTTATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATCGGAGGATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCACGTA TAAATAATATAAGTTTTTGACTTTTACCCCCCTCTTTATTCCTTTTAATTTCGAGAAGAATTGTCGAAAATGGAGCAGGTACAGGATGAACTGTCTACCCCCCTTTATCTTCTAATATTGC TCACAGAGGCTCTTCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCCGGTATTTCTTCTATTTTAGGTGCTATTAATTTCATTACAACTATTATCAATATACGTATTAATAATTTATCA TTTGATCAAATACCTTTATTTGTTTGATCAGTTGGTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAACTTAAATACTT CTTTTTTCGACCCAGCAGGAGGAGGAGACCCTATTCTTTATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302618C31FDFEFF7FFBC3FCD4.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany [MFNB], illustrated in Fig. 16 a, bears five rectangular labels, the first two handwritten and others printed: four white [Bolivia | Torochita | 90. Garl.], [meleagris | Hopff.], [Coll. | Satudinger], [DNA sample ID: | NVG- 22112 E 04 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Cremna telarania | Grishin]. Paratype: 1 ♀ with the same data as the holotype (NVG- 22112 E 11, GenBank barcode OR 939284, Fig. 16 b). Type locality. Bolivia: La Paz Department, Mapiri.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302618C31FDFEFF7FFBC3FCD4.taxon	etymology	Etymology. In Spanish, la telaraña means spider web. The name is given for the cobweb wing pattern of this species. The name is a feminine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302618C31FDFEFF7FFBC3FCD4.taxon	distribution	Distribution. Currently known only from the La Paz Department in Bolivia.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302608C34FE5AF9CAFCA1FDDF.taxon	description	A species list of Napaeina J. Hall, 2003 assigned to genera The list below is mostly based on previously published results (Callaghan and Lamas 2004; Hall 2005; Seraphim et al. 2018; Zhang et al. 2021) guided by the genome-level phylogeny (Fig. 20) and is given to correct some ambiguities and mistakes. For example, Zhang et al. (2021) gave an erroneous combination Napaea sanarita (Schaus, 1902) (type locality in Brazil: Rio de Janeiro) while correctly resurrecting the genus Eucorna Strand, 1932 of which Eucora sanarita Schaus, 1902 is the type and the only species Cremna E. Doubleday, 1847 (type species Papilio actoris Cramer, 1776), not Napaea Hübner, 1819 (type species Cremna eucharila Bates, 1867) (Fig. 20). Assignment of species to genera follows our study (Zhang et al. 2021), and we attempt arranging species in the list to maximize the phenotypic similarity of the neighbors but without disrupting a phylogenetic order given by genomic trees (Fig. 20): i. e., a strongly supported clade in the trees is a continuous segment in the list. We start with Hyphilaria, but the order of the entire list can be reversed. We put Cremna and Napaea next to each other because species in these genera are similar (Hall 2005). To maintain phylogenetic order, the considerations above necessitate placing Ithomiola last. Finally, we situate Eucorna next to Cremna instead of it being last in the list because Eucorna looks more different from Ithomiola than from Cremna. Similar arguments were applied within each genus. Further suggestions about the order to optimize similarity in appearance between neighbors are encouraged. Only valid names of genera and species are given below; for subspecies, see the Butterflies of America website (Warren et al. 2023); for synonyms and taxonomic discussions, see other publications (Callaghan and Lamas 2004; Hall 2005). Type genus (for family-group names) or type species (for genusgroup names) names are given in parenthesis, and names of type species are underlined. Tribe Mesosemiini Grote, 1898 (Mesosemia Hübner, [1819]) Subtribe Napaeina J. Hall, 2003 (Napaea Hübner, [1819]) Genus Hyphilaria Hübner, [1819] (Hyphilaria nicia Hübner, [1819]) Hyphilaria anthias (Hewitson, 1874) Hyphilaria nicia Hübner, [1819] Hyphilaria parthenis (Westwood, 1851) Genus Eucorna Strand, 1932 (Eucora sanarita Schaus, 1902) Eucorna sanarita (Schaus, 1902) Genus Cremna E. Doubleday, 1847 (Papilio actoris Cramer, 1776)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302608C34FE5AF9CAFCA1FDDF.taxon	description	Cremna radiata (Godman & Salvin, 1886) Cremna dentata (Stichel, 1910), stat. nov. Cremna theata (Stichel, 1910) Cremna actoris (Cramer, 1776) Cremna heteroea H. Bates, 1867 Cremna telarania Grishin, sp. n. Cremna calitra Hewitson, 1869 Genus Napaea Hübner, [1819] (Cremna eucharila Bates, 1867) Napaea sylva (Möschler, 1877) Napaea beltiana (H. Bates, 1867) Napaea dramba (J. Hall, Robbins & Harvey, 2004) [fossil] Napaea danforthi A. Warren & Opler, 1999 Napaea umbra (Boisduval, 1870) Napaea loxicha (RG. Maza & J. Maza, 2016) Napaea maya (J. Maza & Lamas, 2016) Napaea necaxa (RG. Maza & J. Maza, 2018) Napaea totonaca (RG. Maza & J. Maza, 2016)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302608C34FE5AF9CAFCA1FDDF.taxon	description	Napaea fratelloi J. Hall & Harvey, 2005 Napaea eucharila (H. Bates, 1867) Napaea frustatoria Brévignon, 2019 Napaea phryxe (C. Felder & R. Felder, 1865) Napaea agroeca Stichel, 1910 Napaea cebrenia (Hewitson, [1873]) Napaea zikani Stichel, 1923 Napaea elisae (J. Zikán, 1952) Napaea joinvilea J. Hall & Harvey, 2005 Napaea melampia (H. Bates, 1867) Napaea mellosa J. Hall & Harvey, 2005 Napaea gynaecomorpha J. Hall, Harvey & Gallard, 2005 Napaea merula (Thieme, 1907) Genus “ new genus 1 ” Seraphim et al. 2018 “ Napaea ” thasus (Stoll, 1780) comb. nov. [placed in its possible sister genus for now just to have a genus name] Genus Ithomiola C. Felder & R. Felder, 1865 (Ithomiola floralis C. Felder & R. Felder, 1865) Ithomiola eburna (J. Hall & Harvey, 2005) Ithomiola candidata (Hewitson, 1874) Ithomiola oweni (Schaus, 1913) Ithomiola calculosa J. Hall & Harvey, 2005 Ithomiola theages (Godman & Salvin, 1878) Ithomiola cribralis (Stichel, 1915) Ithomiola neildi (J. Hall & Willmott, 1998)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302608C34FE5AF9CAFCA1FDDF.taxon	description	Ithomiola nepos (Fabricius, 1793) Ithomiola orpheus (Westwood, 1851) Ithomiola callixena (Hewitson, 1870) Ithomiola buckleyi J. Hall & Willmott, 1998 Ithomiola floralis C. Felder & R. Felder, 1865	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302658C35FE6DFD0EFE64FDD9.taxon	description	Although traditionally treated as distinct (and monophyletic) genera for more than 170 years, Lyropteryx Westwood, 1851 (type species Lyropteryx apollonia Westwood, 1851) and Necyria Westwood, 1851 (type species Necyria bellona Westwood, 1851) are genetically (Fig. 21) and phenotypically close. COI barcodes of their type species differ by 2.7 % (18 bp), which is typical for closely related sister species, not different genera, and both genera are characterized by lyre- or harp-like wing patterns resulting from metallic overscaling between the veins complemented with red spots or stripes. A novice cannot easily assign a species to a genus by wing patterns. For all these reasons, we propose to treat these monophyletic groups as subgenera. Necyria and Lyropteryx were proposed in the same work issued on the same day (Westwood 1851), and being the first revisers, we give precedence to Lyropteryx because this name is more descriptive of a butterfly appearance: its wing (πτέρυξ - pteryx) resembles the musical instrument lyre (λύρα - lyra). Therefore, we propose that Necyria Westwood, 1851, stat. nov. is a subgenus of Lyropteryx Westwood, 1851.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302648C3AFDCCF9BAFD62FE59.taxon	type_taxon	Type species. Eurygona? pulcherrima Herrich-Schäffer, [1853]. Definition. As shown above, Eurygona? pulcherrima Herrich-Schäffer, [1853] (type locality in Suriname) belongs to the genus Isapis E. Doubleday, 1847 (type species Papilio agyrtus Cramer, 1777) and not to Themone Westwood, 1851 (type species Helicopis pais Hübner, [1820]) (Fig. 21). However, it is genetically differentiated from the type species of Isapis at the subgenus level, e. g., their COI barcodes differ by 6.5 % (43 bp). Therefore, we propose that the lineage with Isapis pulcherrima represents a new subgenus. This subgenus differs from its relatives by a combination of the following characters: each wing is blackish-brown with a yellow stripe by its base beneath (as in the type species of Isapis) and on the hindwing. In DNA, a combination of the following characters is diagnostic in the nuclear genome: cne 3301.6.2: T 166 A, cne 3301.6.2: C 186 T, cne 178.3.20: T 1233 A, cne 178.3.20: T 1632 A, cne 37196.1.3: A 87 T and in COI barcode: T 67 A, T 82 C, A 211 G, 223 A, A 268 T, T 625 G.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302648C3AFDCCF9BAFD62FE59.taxon	etymology	Etymology. The name of the type species, pulcherrima, is a Latin word meaning very beautiful, most beautiful, or prettiest. The name of the new subgenus is formed from the Greek word Καλλίτερη (kallíteri), which means most beautiful. The name is a feminine noun in the nominative singular. Species included. Only the type species. Parent taxon. Genus Isapis E. Doubleday, 1847.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3026B8C3AFDD0FDB9FD62FAEB.taxon	type_taxon	Type species. Themone poecila H. Bates, 1868. Definition. As shown above, Themone poecila H. Bates, 1868 (type locality Brazil: Amazonas, Ega [= Tefé]) belongs to the genus Isapis E. Doubleday, 1847 (type species Papilio agyrtus Cramer, 1777) and not to Themone Westwood, 1851 (type species Helicopis pais Hübner, [1820]) (Fig. 21). However, it is genetically differentiated from the type species of Isapis at the subgenus level, e. g., their COI barcodes differ by 8.1 % (53 bp) and is sister to the clade of two subgenera: Isapis and Callitera subgen. n. Therefore, we propose that the lineage with Isapis poecila represents a new subgenus. This subgenus differs from its relatives by a combination of the following characters: each wing is blackish-brown with a yellow-orange area towards the base and a central yellow spot, which may be vestigial on the dorsal side. In DNA, a combination of the following characters is diagnostic in nuclear genome: cne 792.14.1: C 927 T, cne 792.14.1: A 132 T, cne 2411.1.1: A 348 T, cne 5004.10.6: A 822 T, cne 5004.10.6: G 633 A, cne 5335.1.1: C 114 C (not T), cne 5335.1.1: T 129 T (not C), cne 5331.3.1: A 53 A (not G), cne 5331.3.1: T 237 T (not C), cne 573.8.1: C 63 C (not G) and in COI barcode: A 4 C, C 81 T, T 88 A, A 278 A, 421 C, A 586 A.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3026B8C3AFDD0FDB9FD62FAEB.taxon	etymology	Etymology. The name of the type species, poecila, typically refers to colorful or variegated markings or patterns. It is derived from the Greek word ποικίλος (poikilos), which means varied, diverse, or multicolored. The name of the new subgenus is formed from the Spanish word matizado, which means variegated or mottled. The name is treated as a feminine noun in the nominative singular. Species included. Only the type species. Parent taxon. Genus Isapis E. Doubleday, 1847.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3026A8C3BFDE5FF3AFC93FC6C.taxon	type_taxon	Type species. Lyropteryx diadocis Stichel, 1910. Definition. As shown above, Lyropteryx diadocis Stichel, 1910 (type locality in Brazil: Amazonas) belongs to the genus Paraphthonia Stichel, 1910 (type species Monethe molione Godman, 1903) and not to Lyropteryx Westwood, 1851 (type species Lyropteryx apollonia Westwood, 1851) (Fig. 21). However, it is genetically differentiated from the type species of Paraphthonia at the subgenus level, e. g., their COI barcodes differ by 6.1 % (40 bp). Therefore, we propose that the lineage with Paraphthonia diadocis represents a new subgenus. This subgenus differs from its relatives by a combination of the following characters: forewing vein R 2 originates at the anterior distal corner of the discal cell, the forewing with the orange-yellow band from mid-costa to near tornus, and the hindwing with metallic-green overscaling around veins in distal half. In DNA, a combination of the following characters is diagnostic in the nuclear genome: cne 3461.1.26: A 146 G, cne 3461.1.26: A 1989 G, cne 6404.2.4: C 87 T, cne 945.5.1: A 342 T, cne 945.5.1: T 352 C, cne 3615.3.2: A 132 A (not G), cne 4618.3.1: C 31 C (not G), cne 4618.3.1: C 37 C (not G), cne 6843.7.6: G 489 G (not A), cne 6843.7.6: T 525 T (not C) and in COI barcode: T 100 A, C 284 T, T 286 A, A 352 C, T 355 A, A 604 G.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3026A8C3BFDE5FF3AFC93FC6C.taxon	etymology	Etymology. In its appearance, the type species of this subgenus resembles some species from the genus Panara E. Doubleday, 1847 (type species Papilio jarbas Drury, 1782), and the prefix “ para ” means alongside, near, beyond, or similar to. The name is a feminine noun in the nominative singular. Species included. Only the type species. Parent taxon. Genus Paraphthonia Stichel, 1910.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3026F8C3CFE39FD91FCB2FA61.taxon	diagnosis	Definition and diagnosis. The Z chromosome analysis of Euriphellus Austin, 2008 (type species Papilio euribates Stoll, 1782) reveals that four specimens from Colombia and Ecuador form a clade sister to several Euriphellus species that is genetically differentiated from them (Fig. 26 a). Therefore, these specimens belong to species distinct from the rest. The two pairs of specimens are genetically differentiated from each other, e. g., COI barcode differences of 4.9 % (32 bp) between them (possible introgression with Euriphellus lama (Evans, 1952), Fig. 26 b), and belong to two different new species. The one from western Colombia is described here, and the one from eastern Ecuador is described below. The new species from Colombia keys to D. 4.2 (b) in Evans (1952), and differs from its relatives by the following combination of characters in male: dorsal wing color yellower in hue, forewing without submarginal hyaline spots in cells M 1 - M 2, M 2 - M 3, or R 3 - R 4, only two yellow hyaline subapical spots in cells R 4 - R 5 and R 5 - M 1, hindwing with six well-developed and nearly collected into a band postdiscal brown spots on dorsal side, one in each cell between veins RS and 1 A + 2 A, ventrally with prominent yellow spots, including near the base of cell Sc + R 1 - RS (Fig. 27 a), tegumen narrower in dorsal view, harpe = longer = than = in = relatives, = humped = along = ventral = margin, = expanded = into = a = keel = with = several = small = teeth = on = dorsal = side = and = narrows = to = a = point, = ampulla = with = a = nearly = square = process, = flattened = along = its = somewhat = irregular = dorsoposterior = margin = (Fig. = 28 a, b); = and = female = with = larger = discal = forewing = hyaline = spots, = the = spot = in = cell = M 3 - CuA 1 = overlaps = the = spot = in = cell = CuA 1 - CuA 2 = by = most = of = its = width = (Fig. 27 c). Due to unknown phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly 2582.35.2: G 1861 A, aly 2582.35.2: C 1862 G, aly 767.18.5: A 88 T, aly 767.18.5: T 117 A, aly 54.32.1: C 215 G and in COI barcode: A 181 G, T 259 C, C 343 T, T 364 C, T 376 A, T 484 T, T 553 A. Barcode sequence of the holotype. Sample NVG- 18052 E 08, GenBank OR 837728, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATGTTAGGAACTTCTTTAAGTTTACTAATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAAATGATCAAATTTATAATACT ATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTAATGCCTATTATAATTGGGGGATTCGGAAACTGATTAGTACCATTAATATTAGGAGCCCCAGATATAGCTTTTCCACGAA TAAATAATATAAGATTCTGATTACTTCCCCCTTCTTTAATATTATTAATTTCAAGAAGAATCGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCTCCTTTATCTGCTAACATTGC CCATCAAGGATCATCAGTTGATTTAGCAATTTTTTCTCTTCACTTAGCTGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAACTTATCT TTCGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCTTTATTATTACTTCTCTCTTTACCAGTACTAGCAGGTGCAATTACTATATTATTAACAGACCGAAATTTTAATACAT CTTTTTTTGATCCTTCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3026F8C3CFE39FD91FCB2FA61.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany [MFNB], illustrated in Fig. 27 a, bears four printed labels: 1 st green, two white [W. Columb. | Rio Dagua | 600 - 1000 m | W. Hopp S. | 2 - 5] (the last line is rotated 90 ° to the left and printed on the right margin of the label), [DNA sample ID: | NVG- 18052 E 08 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 22111 G 11 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Euriphellus | colombiensis Grishin]. The first NVG number corresponds to a sampled leg, and the second is for the abdomen DNA extraction followed by genitalia dissection. Paratype: 1 ♀ with the same data as the holotype (NVG- 18052 E 11, GenBank barcode OR 837729, Fig. 27 c). Type locality. Colombia: Río Dagua, 600 – 1000 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3026F8C3CFE39FD91FCB2FA61.taxon	etymology	Etymology. The name is given for the country of the type locality. The name is a masculine adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3026F8C3CFE39FD91FCB2FA61.taxon	distribution	Distribution. Currently known only from Colombia.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3026D8C3DFE33F9BCFC86FBCD.taxon	diagnosis	Definition and diagnosis. Genomic analysis of Euriphellus Austin, 2008 (type species Papilio euribates Stoll, 1782) reveals that four specimens from Colombia and Ecuador form a clade sister to several Euriphellus species that is genetically differentiated from them (Fig. 26). Therefore, these specimens belong to species distinct from the rest. The two pairs of specimens are genetically differentiated from each other, e. g., COI barcode differences of 4.9 % (32 bp) between them, and belong to two different new species. The one from eastern Ecuador is described here, and the one from western Colombia is described above. The new species from Ecuador keys to D. 4.2 (b) in Evans (1952), and differs from its relatives by the following combination of characters in males: wings not as rounded as in Euriphellus mena (Evans, submarginal hyaline spots in cells M 1 - M 2, M 2 - M 3, and R 3 - R 4, and larger hyaline subapical spots in cells R 4 - R 5 and R 5 - M 1, hindwing with five weaker-developed and separated postdiscal brown spots on dorsal side, one in each cell between veins RS and CuA 2, ventrally with prominent yellow spots, but not near the base of cell Sc + R 1 - RS (Fig. 27 b), tegumen broader in dorsal view, harpe shorter than in Euriphellus colombiensis sp. n., only weakly humped along ventral margin, no dorsal keel, and narrows to a point, ampulla with a rounded thumb-like process with somewhat irregular margins (Fig. 28 c, d); and female with smaller discal forewing hyaline spots, the spot in cell M 3 - CuA 1 offset distad from the spot in cell CuA 1 - CuA 2 not overlapping with it (Fig. 27 d). Due to unknown phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly 331.26.8: C 109 A, aly 331.26.8: G 267 A, aly 331.26.8: T 291 C, aly 536.154.1: A 618 G, aly 536. 154.1: T 631 C and in COI barcode: A 28 G, T 91 A, A 229 G, C 343 A, G 474 A, A 538 G, T 544 A, T 607 C, T 634 C. Barcode sequence of the holotype. Sample NVG- 18057 G 01, GenBank OR 837730, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGGGCAGGAATACTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAACTCCCGGTTCATTAATTGGAAATGATCAAATTTATAATACT ATTGTTACAGCCCATGCTTTTATTATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTACCATTAATATTAGGAGCCCCAGATATGGCTTTTCCACGAA TAAACAATATAAGATTTTGATTACTTCCACCTTCTTTAATATTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCACCTTTATCTGCTAATATTGC TCACCAAGGATCTTCAGTTGATTTAGCAATTTTTTCACTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAACTTATCT TTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCTTTATTATTGCTTCTATCTTTACCTGTATTAGCAGGTGCAATTACTATATTATTAACAGACCGAAATTTTAATACAT CCTTTTTTGATCCTTCTGGAGGAGGAGACCCTATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3026D8C3DFE33F9BCFC86FBCD.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Zoologische Staatssammlung München, Germany [ZSMC], illustrated in Fig. 27 b, bears five printed labels: four white [Canelos | Ecuador or.], [Collection | v. Rosen], [DNA sample ID: | NVG- 18057 G 01 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23012 A 09 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Euriphellus | ecuadoricus Grishin]. The first NVG number corresponds to a sampled leg, and the second is for the abdomen DNA extraction followed by genitalia dissection. Paratype: 1 ♀ with the same data as the holotype (NVG- 18057 G 02, GenBank barcode OR 837731, Fig. 27 d). Type locality. Ecuador: Canelos.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3026D8C3DFE33F9BCFC86FBCD.taxon	etymology	Etymology. The name is given for the country of the type locality. The name is a masculine adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3026D8C3DFE33F9BCFC86FBCD.taxon	distribution	Distribution. Currently known only from Ecuador.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302538C00FE54FE44FA3DFF29.taxon	diagnosis	Definition and diagnosis. The nuclear genome tree reveals a prominent clade of two specimens from Cuba (Fig. 29 red) initially identified as Urbanus proteus domingo (Scudder, 1872) (type locality in Haiti) that is sister to all other Urbanus proteus (Linnaeus, 1758) (type locality in America) we sequenced (Fig. 29 blue branches), and is placed approximately halfway between U. proteus and its sister species Urbanus velinus (Plötz, 1881) (type locality in Brazil: Bahia) (Fig. 29 green). The two specimens are strongly differentiated genetically from U. p. domingo (Fig. 29 violet, orange, and magenta labels), including two other specimens from Cuba (southeastern region) (Fig. 29 magenta labels): Fst / Gmin / COI barcode difference of 0.51 / 0.00 / 0.8 % (5 bp, barcodes are similar between the two species). Therefore, these two specimens represent a species distinct from U. proteus. This new species keys to C. 13.1 (b) in Evans (1952) and differs from its closest relative U. proteus in broader and straighter ventral hindwing dark brown bands and a darker area by mid-costa, hyaline spot in forewing cell CuA 1 - CuA 2 closer aligned with the spot in discal cell rather than shifted distad, absent or small submarginal hyaline spots in forewing cells M 1 - M 2 and M 2 - M 3, and narrower antrum (Fig. 31 blue arrows). Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly 103.33.9: A 90 G, aly 103.33.9: T 160 C, aly 103.33.9: G 162 C, aly 207.9.6: A 180 G, aly 103.50.3: T 60 C and in COI barcode: C 220 C, T 322 C, T 385 C, T 610 C, C 616 T. Barcode sequence of the holotype. Sample NVG- 18057 F 12, GenBank OR 837732, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTCATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTAGTTCCATTAATAATAGGTGCCCCTGATATAGCTTTCCCCCGTA TAAATAATATAAGATTTTGATTATTACCCCCTTCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGTACCGGATGAACAGTCTATCCCCCTCTTTCATCTAATATTGC CCACCAAGGAGCTTCCGTTGACCTAGCAATTTTTTCTCTTCATCTTGCTGGAATTTCATCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTCTCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTCTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302538C00FE54FE44FA3DFF29.taxon	materials_examined	Type material. Holotype: ♀ deposited in the Zoologische Staatssammlung München, Germany [ZSMC], illustrated in Fig. 30 a, bears six labels: four white, the 3 rd greenish [CUBA, La Habana, | Boyeros, Finca La | Chata (23.036 N, - | 82.376 W), July 9 2014 | R. Núñez leg.], [RNA- 1 - 171], [BC ZSM Lep 92903], [DNA sample ID: | NVG- 18057 F 12 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23012 A 03 | c / o Nick V. Grishin], and one red [HOLOTYPE ♀ | Urbanus (Urbanus) | cubanus Grishin]. The first NVG number corresponds to a sampled leg, and the second is for the abdomen DNA extraction followed by genitalia dissection. Paratype: 1 ♀ Cuba, Gundlach leg., Coll. Thieme, genitalia vial NVG- 22111 G 12 (NVG- 21126 H 02, GenBank barcode OR 837733, Fig. 30 b) [MFNB]. Type locality. Cuba: Havana, Boyeros, Finca La Chata, GPS 23.036, − 82.376.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302538C00FE54FE44FA3DFF29.taxon	etymology	Etymology. The name is given for the country of the type locality. The name is a masculine adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302538C00FE54FE44FA3DFF29.taxon	distribution	Distribution. Cuba; currently confirmed from the northwestern region (Havana). reddish-brown, Fig. 30) is due to fading with age: the paratype was collected more than a century ago.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302518C01FEA5FC53FC63FE27.taxon	description	from Gorgythion begga (Prittwitz, 1868) Gorgythion marginata Schaus, 1902 (type locality in Peru) (Fig. 34 red) currently regarded as a junior subjective synonym of Gorgythion begga pyralina (Möschler, 1877) (type locality in Suriname) (Fig. 34 blue, part) is genetically differentiated from it and generally from Gorgythion begga (Prittwitz, 1868) (type locality in Brazil: Rio de Janeiro) at the species level (Fig. 34), e. g., Fst / COI barcode difference of 0.26 / 2.9 % (19 bp). Therefore, we propose that Gorgythion marginata Schaus, 1902, stat. rest. is a species-level taxon distinct from Gorgythion begga (Prittwitz, 1868).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302508C07FE14FA50FBA3FDCF.taxon	description	(Figs. 34 part, 35, 36)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302508C07FE14FA50FBA3FDCF.taxon	diagnosis	Definition and diagnosis. Genomic analysis of Gorgythion Godman & Salvin, 1896 (type species Helias pyralina Möschler, 1877) reveals that a specimen from Guyana (NVG- 15043 F 10) (Figs. 34 magenta, 35) while being sister to Gorgythion begga (Prittwitz, 1868) (type locality in Brazil: Rio de Janeiro) (Fig. 34 blue), is not grouping closely with any of the described species (Fig. 34) and therefore is new. It exhibits COI barcode differences of 2.4 % (16 bp) from Gorgythion begga pyralina (Möschler, 1877) (type locality in Suriname). This new species keys to E. 36.1 (a) in Evans (1953) and differs from its relatives in nearly unmarked dark-brown dorsal hindwing with convex outer margin, rounder than in Gorgythion plautia (Möschler, 1877) (type locality in Suriname) (Fig. 34 cyan), ventral hindwing without white area towards tornus, forewing not prominently truncate or produced at the apex, with developed markings and broad pale-brown areas (Fig. 35); left valva broader at the base, and expansion of its ampulla curved inward, appearing truncate in lateral view (Fig. 36). Due to unknown phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly 1313.36.6: C 75 T, aly 1497.9.9: A 87 G, aly 361.8.3: T 111 C, aly 361.8.3: C 126 T, aly 13198.6.3: G 318 C, aly 1204.4.2: G 54 G (not A), aly 1166.4.2: A 30 A (not C), aly 1166.4.2: T 42 T (not C), aly 770.15.7: A 12 A (not G), aly 770.15.7: G 30 G (not A) and in COI barcode: T 59 C, T 172 T, A 181 G, T 280 T, T 463 C, T 574 C.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302508C07FE14FA50FBA3FDCF.taxon	description	AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCTTTAAGATTACTAATTCGAACTGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGGGGATTTGGAAATTGACTTGTTCCATTAATATTAGGAGCCCCTGATATAGCATTCCCCCGAA TAAATAATATAAGATTTTGACTTTTACCTCCTTCCCTTATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCTCCTCTTTCAGCTAATATTGC CCATCAGGGGGCATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAGAAATTTATCT TTTGATCAAATACCATTATTTGTTTGAGCAGTAGGTATTACTGCATTACTTTTATTATTATCATTACCTGTTTTAGCAGGTGCTATTACCATATTATTAACAGATCGAAATTTAAATACAT CATTTTTTGACCCTGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302508C07FE14FA50FBA3FDCF.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 35, bears five labels: four white [GUYANA: ESSEQUIBO | Mt. Wokomung, 3500 ft. | XI, 1993; S. Fratello], [Genit. Vial No. | SRS- 4628], [Allyn Museum | Acc. 1994 - 5], [DNA sample ID: | NVG- 15043 F 10 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Gorgythion | guyanus Grishin]. Type locality. Guyana: Essequibo, Mt. Wokomung, elevation 3500 ft.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302508C07FE14FA50FBA3FDCF.taxon	etymology	Etymology. The name is given for the country of the type locality. The name is a masculine adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302508C07FE14FA50FBA3FDCF.taxon	distribution	Distribution. Currently known only for the holotype collected in Guyana.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302568C07FE6CFD31FB06FABE.taxon	description	(Plötz, 1883) (type locality not specified, syntype sequenced as NVG- 21116 G 06), currently treated as a subspecies of Pardaleodes incerta (Snellen, 1872) (type locality in Angola), is not monophyletic with it and is sister to the clade of P. incerta (Stoll, 1781) together with Pardaleodes edipus (Stoll, 1781) (type locality in South Africa) (Fig. 37), genetically differentiated from them with Fst / Gmin / COI barcode difference of 0.61 / 0.00 / 4.6 % (30 bp) (P. incerta) and 0.64 / 0.00 / 5.0 % (33 bp) (P. edipus). Therefore, we Fig. 37. The nuclear genome tree (autosomes) of selected propose that Pardaleodes murcia (Plötz, 1883), stat. Pardaleodes species: P. edipus (violet), P. incerta (blue), P. murcia stat. rest. (red), P. tibullus (cyan), P. bule (olive), rest. is a species distinct from Pardaleodes incerta P. sator (green), and P. pusiella stat. rest. (magenta). (Snellen, 1872). Sequencing a series of specimens from additional localities in western Africa and comparing them with genomic sequences of P. murcia syntypes may help in determining the type locality of this species more precisely.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302568C0AFEE0F97AFD50FC6D.taxon	description	http: // zoobank. org / E 1 AE 8324 - 1 FFE- 4 A 14 - 916 D- 8 BCC 85 B 96105 (Figs. 40 part, 41)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302568C0AFEE0F97AFD50FC6D.taxon	diagnosis	Definition and diagnosis. Genomic sequencing of specimens from the southwesternmost population of Limochores mystic (W. H. Edwards, 1863) (type locality in USA: NY, Greene Co., Huner) reveals that they are sister to all other subspecies of L. mystic in the tree inferred from the nuclear genome (autosomes only) (Fig. 40 a), although they fall among other L. mystic populations in the Z chromosome (not shown) and mitogenome trees (Fig. 40 b), and their COI barcodes differ only due to variation. Therefore, this population is likely conspecific with L. mystic; however, being most divergent from all others, it represents a separate and new subspecies. In its duller look with more diffuse boundaries between brown ground color and yellow-orange spots, this subspecies is most similar to Limochores mystic dacotah (W. characters. Males have reduced orange scaling, spots and bands are narrower, e. g., the orange on the dorsal hindwing is reduced to a band approximately the same width as the brown margin, and the band is separated from the orange discal cell by a brownish belt. Both sexes have darker ventral sides of wings. Due to extensive phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly 499.49.4: G 66 C, aly 848.2.19: T 51 C, aly 838. 7.2: C 48 T, aly 838.7.2: T 63 C, aly 1838.42.3: C 34 T. Barcode sequence of the holotype. Sample NVG- 22102 C 07, GenBank OR 837736, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAACCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATACTAGGAGCTCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGATTTTGAATATTACCACCTTCACTAACATTGTTAATTTCAAGAAGAATTGTAGAGAATGGTGCAGGAACAGGTTGAACAGTTTACCCACCTTTATCTTCTAATATTGC ACATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCCGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCA TTTGATCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCTTTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTACTTACAGATCGAAATTTAAATACTT CATTTTTTGACCCAGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302568C0AFEE0F97AFD50FC6D.taxon	materials_examined	Type material. Holotype: ♂ deposited the California Academy of Sciences, San Francisco, CA, USA [CAS], illustrated in Fig. 41 a, bears seven printed (text in italics handwritten) labels: six white [Circle Bar Draw at | Tillman Ranch, 7100 ' | Coconino Co. AZ], [9 June 19 88 | collected by Kilian Roever], [COLLECTION OF | C. D. MacNeill], [Polites mystic | ssp. nov. | Det. C. D. MacNeill ' 98], [DNA sample ID: | NVG- 22102 C 07 | c / o Nick V. Grishin], [{QR Code} CASENT | 8566979], and one red [HOLOTYPE ♂ | Limochores mystic | nino Grishin]. Paratype: 1 ♀ same data as the holotype (NVG- 22102 C 08, CASENT 8566980, Fig. 41 b) [CAS]. Type locality. USA: Arizona, Coconino Co., Circle Bar Draw at Tillman Ranch, 7100 '.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302568C0AFEE0F97AFD50FC6D.taxon	etymology	Etymology. The name is formed from the name of the county of the type locality [Coco] nino and is a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302568C0AFEE0F97AFD50FC6D.taxon	distribution	Distribution. Only known from central Arizona, USA. Populations in southwestern Colorado should be studied to determine their taxonomic identity.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025B8C08FE8FFA62FBB0FC60.taxon	description	(Figs. 42 part, 43)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025B8C08FE8FFA62FBB0FC60.taxon	diagnosis	Definition and diagnosis. Populations of Hesperia pahaska Leussler, 1938 (type locality in USA: Nebraska, Sioux Co.) from southeastern Utah and southwestern Colorado are usually included in Hesperia pahaska martini MacNeill, 1964 (type locality USA: California, San Bernardino Co., 4.5 mi SE of Ivanpah). However, they form a distinct clade in the Z chromosome tree and possess a distinct mitochondrial genome haplotype (Fig. 42 red), representing distinct subspecies. This new subspecies differs from H. p. martini in better outlined and contrasting with fulvous ground color brown outer margins, smaller forewing subapical spots, and usually smaller ventral hindwing white spots; from the nominal Hesperia pahaska by less contrasting with the fulvous colors subapical and submarginal dorsal forewing spots, which are typically paler in H. p. pahaska, and usually more extensive fulvous areas penetrating fuscous margins in females on wings above (more similar to H. p. williamsi in this aspect) and from Hesperia pahaska williamsi Lindsey, 1940 (type locality in USA: Arizona, Pima Co., Baboquivari Mts) by generally larger white ventral hindwing spots. Due to extensive phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly 5021.3.8: C 60 T, aly 7690.1.10: C 45 A, aly 7690.1.10: C 204 T, aly 4196.3.1: C 333 G, aly 4196. 3.1: A 415 G and in COI barcode: T 10 C, T 19 C, G 101 A, 328 C, T 646 C.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025B8C08FE8FFA62FBB0FC60.taxon	description	AACTTTATACTTTATTTTCGGTATTTGAGCTGGTATATTAGGAACTTCATTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATCTTTAATTGGAAATGACCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGACATAGCTTTCCCACGTA TAAATAATATAAGATTTTGAATATTACCACCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGCTGAACTGTTTATCCTCCTTTATCCTCTAATATTGC TCACCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCACTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAACTTATCT TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATACTACTTACTGATCGAAATTTAAATACTT CTTTTTTCGATCCAGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025B8C08FE8FFA62FBB0FC60.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 43 a, bears four printed labels: two white [Pack Creek Day Use Area | La Sal Mountains | San Juan Co, UT | 2 June 2016 | Robb Hannawacker], [Pahaska Skipper | male | Hesperia pahaska], [DNA sample ID: | NVG- 20045 F 06 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Hesperia pahaska | hannawackeri Grishin]. Paratypes: 5 ♂♂ 2 ♀: USA: 1 ♀ Utah, San Juan Co., Poison Canyon, el. 8500 ', 5 - Jun- 2020, R. Hannawacker leg. (NVG- 20045 F 05) (Fig. 43 b); Colorado: Mesa Co.: 2 ♂♂ Black Ridge Breaks, West Reef, 7050 ft, 24 - 25 - May- 2007, M. S. Fisher leg. (NVG- 22055 G 08 & NVG- 22055 G 09); and 1 ♂ BLM lands W of Gateway, Unaweep Seep Natural Area, 10 - Sep- 2017, Paul A. Opler and Evi M. Buckner-Opler leg. (PAO 566); 1 ♂ Delta Co., 4.6 - 7.3 mi. SE of Austin, 6000 - 6600 ft, 12 - Jun- 1983, M. S. Fisher leg. (NVG- 22055 G 10); 1 ♂ 1 ♀ Montrose Co., Gunnison Gorge NWA, Wave-Eagle Trail Loop, 6000 - 6300 ft, 1 - and 3 - Jun- 2016, M. S. Fisher leg. (NVG- 22055 G 11 & NVG- 22055 G 12). Type locality. USA: Utah, San Juan Co., La Sal Mountains, Pack Creek Picnic Area.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025B8C08FE8FFA62FBB0FC60.taxon	etymology	Etymology. The name honors Robb Hannawacker, the collector of the holotype and a female paratype from Utah. Robb is a dedicated Lepidopterist and the author of the book on the butterflies of southeastern Utah. He helped our lab tremendously with genomic studies of butterflies from his region (southeastern Utah) by collecting specimens and connecting us with others who can help further. The name is a masculine noun in the genitive case.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025B8C08FE8FFA62FBB0FC60.taxon	distribution	Distribution. Southeastern Utah and southwestern Colorado in the USA.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302598C0EFE6CFBB8FA33FCAB.taxon	diagnosis	Definition and diagnosis. Genomic sequencing of Pseudocopaeodes eunus (W. H. Edwards, 1881) (type locality USA: Kern Co., the bottoms of Kern River, near Bakersfield) populations reveals that specimens from the Ash Meadows area in southern Nevada are not monophyletic with Pseudocopaeodes eunus alinea J. Scott, 1981 (type locality in USA: California, San Bernardino Co., Afton Canyon) despite the similarity in being less marked than other populations, and form a distinct clade with genetic differentiation larger than for some other P. eunus subspecies (Fig. 44), e. g., their COI barcodes differ by 1.1 % (7 bp). Therefore, the Ash Meadows population represents a new subspecies. This subspecies is most similar to P. e. alinea in appearance and differs from it in having less conspicuous and thinner In particular, palpi beneath, cheeks, area by ventral forewing costa at the wing base, forewing apex, and hindwing overall are whiter (and wing venter redder) than in P. e. alinea, which is yellower (Fig. 45 b). Dorsal hindwing by the apex is usually less dark, and dark scales by the costa are confined mostly to the base. Definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly 1022.2.1: G 558 A, aly 1781.2.2: C 384 T, aly 1781.2.2: G 444 A, aly 4645.18. 2: C 183 T, aly 4645.18.2: T 213 A and in COI barcode can be distinguished from other subspecies, except Pseudocopaeodes eunus obscurus Austin & J. Emmel, 1998 (type locality in USA: Nevada, Carson City): A 214 A, T 220 C, A 484 A, T 514 T, 604 C. Barcode sequence of the holotype. Sample NVG- 21049 E 06, GenBank OR 837738, 658 base pairs: AACTTTATATTTTATTTTTGGTATCTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATAGT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCCCCAGATATAGCTTTCCCACGAA TAAATAATATAAGATTTTGAATATTACCCCCATCATTAATATTATTAATCTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGTTGAACTGTTTATCCTCCTTTATCTTCTAATATTGC TCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCA TTTGACCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCTTTATTATTATTATTATCTTTACCTGTATTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACCT CTTTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302598C0EFE6CFBB8FA33FCAB.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 45 a, bears four labels, 1 st handprinted others printed: three white [ASH MEADOWS | NYE CO. NEV. | 2 SEPT. 1989 | LEG: P. SAVAGE], [P Savage colln. | MGCL Acc. | 2006 - 15], [DNA sample ID: | NVG- 21049 E 06 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Pseudocopaeodes | eunus ash Grishin]. Paratypes: 2 ♂♂ 2 ♀♀ same locality as the holotype: 2 ♂♂ 6 - Sep- 1987, P. Savage colln. (NVG- 22076 F 04 and NVG- 22076 F 05) [MGCL], 1 ♀ 7 - Sep- 1988, P. Savage leg. (NVG- 21049 E 07) [MGCL], and 1 ♀ 12 - Aug- 1984 G. T. Austin leg. (NVG- 20063 G 12, CSU _ ENT 1028906) [CSUC].	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302598C0EFE6CFBB8FA33FCAB.taxon	etymology	Etymology. The name is given for the type locality and the ashier appearance: paler, whiter, ventrally dusted with white compared to other subspecies. The name is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302598C0EFE6CFBB8FA33FCAB.taxon	distribution	Distribution. Southern Nevada; known only from the Ash Meadows area.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302598C0EFE6CFBB8FA33FCAB.taxon	discussion	Comments. First, we note that where P. eunus is double-brooded, the two broods differ in appearance. The first one produces darker specimens with broader dark-framed veins and more conspicuous two pale rays of the ventral hindwing, thus having a classical P. eunus appearance. The second brood produces paler specimens. Therefore, wing patterns within the broods should be compared between populations to reach meaningful conclusions. Second, we see that genetic differentiation between the two subspecies Pseudocopaeodes eunus obscurus Austin & J. Emmel, 1998 (type locality in USA: Nevada, Carson City) and Pseudocopaeodes eunus flavus Austin & J. Emmel, 1998 (type locality in USA: Nevada, Churchill Co.) is limited compared to others (Fig. 44), suggesting that they are not particularly distinct from each other, despite their phenotypic difference in wing patterns. Thus, wing patterns can differ with very few genetic changes. Third, we observe the genetic similarity between the lectotype of Copaeodes wrightii W. H. Edwards, 1882 (type locality USA: California, San Bernardino Co., nr. Victorville) currently treated as a junior subjective synonym of the nominal P. eunus and the type series of Pseudocopaeodes eunus alinea J. Scott, 1981 (type locality USA: California, San Bernardino Co., Afton Canyon) (Fig. 44). While additional analyses are required, it may be that C. wrightii is not a synonym of P. e. eunus, but instead is a valid subspecies and the same taxon as P. e. alinea, with the latter being its junior subjective synonym.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025F8C0EFEE6FCC8FC8AF9E0.taxon	description	(NVG- 15096 F 09) (Fig. 46). Therefore, we propose that Pamphila milo W. H. Edwards, 1883 is a junior subjective synonym of Ochlodes agricola verus (W. H. Edwards, 1881), and not of Ochlodes agricola nemorum (Boisduval, 1852) (type locality in USA: California, Plumas Co.) as currently treated. While sequencing of additional specimens of Ochlodes agricola (Boisduval, 1852) (type locality in USA: California, Marin Co.) for population analysis is needed for confident conclusions, our phylogenetic Fig. 46. The nuclear genome tree (autosomes) of Ochlodes analysis tentatively suggests that the type locality of agricola subspecies: O. a. agricola (blue), O. a. nemorum P. milo might have been in Kern Co., California, (green), and O. a. verus (violet, with its junior subjective synonym Pamphila milo in magenta). possibly even “ Havilah ”, together with O. a. verus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025F8C0FFE4CF93DFAEDFCBF.taxon	description	especially on the inner margin, narrow and pale brown. Hindwing underside reddish-yellow with a faded yellow band ”. Published on plate 180 (row i, images 4 and 5 from the left) illustration of H. amanda in Draudt (1921 – 1924) (Fig. 47) is, according to our reading of Evans (1955), paler than inspected by Evans copy of Plötz’s original drawing t [afel]. 617. Indeed, Draudt’s illustration agrees well with the original description and likely reflects the appearance of this species. In our opinion, H. amanda is conspecific neither with H. ottoe nor with O. s. napa largely because the stigma in H. amanda extends into cell 3 (i. e., M 3 - CuA 1), forewing brown streak distad of the discal cell is confined to the cell 5 (i. e., M 1 - M 2), and the inner margin of dorsal hindwing is only narrowly brown, with a paler-brown outer margin by the tornus. These characters do not match the former two species. The stigma reaches into cell 3 in many Indo-Australian Hesperiidae, but we are not able to associate H. amanda with any species known to us. Therefore, we propose to treat this name as nomen dubium, pending further research.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025D8C0DFE3DFE63FBB8FCA6.taxon	description	(Figs. 48 part, 49)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025D8C0DFE3DFE63FBB8FCA6.taxon	diagnosis	Definition and diagnosis. Genomic sequencing reveals that specimens of Ochlodes napa (W. H. Edwards, 1865), stat. rest. (type locality in USA: Colorado, Clear Creek Co.) from the southwestern part of the range are genetically differentiated from the rest (Fig. 48) with the COI barcode difference of 2.0 % (13 bp). This difference is large because they possess mitochondrial genomes (and therefore COI barcodes) more similar to Ochlodes sylvanoides (Boisduval, 1852) (type locality in USA: California, Plumas Co.) than to O. napa (Fig. 48 b). Due to this genetic differentiation, these populations from Coconino Co. in Arizona represent a distinct taxon that currently does not have a name and therefore is new. We consider it to be a subspecies of O. napa because genetic differentiation in the nuclear genome is not prominent (Fig. 48 a), and we are not aware of this new taxon being sympatric with O. napa. This new subspecies is characterized by a darker appearance, sharper edges of brown areas likely caused by reduced fulvous overscaling over the brown areas, especially near their edges (e. g., the brown spot distad of the discal cell on forewing), and submarginal spots in cells M 1 - M 2 and M 2 - M 3 are better separated from fulvous areas of the forewing. Its females tend to have more developed fulvous areas in the forewing provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly 1500.7.2: A 162 T, aly 1500.7.2: T 170 A, aly 3598.15.2: G 447 A, aly 3598.15.2: C 459 T, aly 378.20.4: A 390 G and in COI barcode: A 217 A, A 256 C, T 439 C, T 505 C, T 583 T, T 616 C. Barcode sequence of the holotype. Sample NVG- 21113 C 07, GenBank OR 837739, 658 base pairs: AACTTTATACTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGTGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAA TAAATAATATAAGCTTTTGAATATTACCTCCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTATATCCTCCTTTATCTTCTAATATTGC TCACCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCATCTATTCTAGGAGCTATCAATTTTATTACAACAATTATTAATATACGAATTAAAAACTTATCA TTTGATCAAATACCCTTATTCGTATGATCAGTAGGTATTACAGCATTATTATTATTATTATCTTTACCTGTCTTAGCAGGTGCTATTACAATATTACTTACTGATCGAAATTTAAATACTT CTTTTTTTGACCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025D8C0DFE3DFE63FBB8FCA6.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 49 a, bears four printed labels: three white [South Canyon Spring | Kaibab Plateau, AZ | 30 July 2021 | Robb Hannawacker], [Woodland Skipper | Ochlodes sylvanoides | male], [DNA sample ID: | NVG- 21113 C 07 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ Ochlodes napa | kaibab Grishin]. Paratype: 1 ♀ same data as the holotype (NVG- 21113 C 06) (Fig. 49 b). Type locality. USA: Arizona, Coconino Co., Kaibab Plateau, South Canyon Spring.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025D8C0DFE3DFE63FBB8FCA6.taxon	etymology	Etymology. The name is a noun in apposition taken from the type locality of this species.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025D8C0DFE3DFE63FBB8FCA6.taxon	distribution	Distribution. Northern Arizona, USA. Populations in southeastern Utah are the nominal subspecies, and those in southwestern Utah should be studied to determine their identity.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025C8C11FE81FCC3FDC3FCA7.taxon	description	Hesperia erratica Plötz, 1883 (type locality in Guatemala), currently a junior subjective synonym of Lon zabulon (Boisduval & Le Conte, [1837]) (type locality in North America, possibly USA: Georgia), was described from an unstated number of specimens from Guatemala (Plötz 1883). One specimen, shown in Fig. 50 a, is curated in the MFNB collection as a syntype of H. erratica. We determine that this specimen is indeed a syntype. First, it agrees with the original description, which we translate as: “ Yellow on both sides, all wings dark at the base and outer margin. Hindwing underside straw-yellow, at the base pale-brown with yellow spot, cell 1 b is overscaled with pale-brown. Three such spots are in an oblique line in cell 1 c, 2, and 3, one spot in the discal cell near the brown base, and a patch in the corner of cell 6. In cell 7 at the apex, there is a small brown spot, like the previous ones, and in cell 6, the narrow uneven border begins, ending at vein 1 b. Upperside dark-yellow, forewing with brown-powdered [refers to the following list], the apical spots ending at the costal margin, such long spot in cells 4 and 5, and a dark brown cross vein. Hindwing with a brown costal margin, narrow in cells 4 and 5, then rapidly widening outer border, and a broad inner margin. Fringes of the forewing light brown, and of the hindwing yellow. ” The description does not mention a diffuse discal spot in hindwing cell 5 (i. e., M 1 - M 2) beneath, present in the syntype, but all its other characters are in very good agreement with the description. Second, according to its labels, this candidate syntype specimen from the Weymer collection was seen by Plötz, who identified it at the time as “ zabulon Bd. ” (“ best [immt]. v [on]. Plötz ”). Subsequently, Plötz likely changed his mind because, in his publication with the key describing H. erratica, he placed it after his “ zabulon ”, which was actually Lon hobomok (T. Harris, 1862) (type locality in USA: Massachusetts) (Plötz 1883). This is also corroborated by the opinion of Godman (1907), who inspected the original Plötz drawings of “ zabulon ” (t [afel]. 655) “ from Buffalo ” and concluded that they “ represent A. hobomok. ” Thus, Plötz’s “ zabulon ” was L. hobomok, and Plötz probably proposed the name erratica for the true L. zabulon, represented by this specimen, after he realized that two species were involved (see specimen labels below). Third, the specimen bears a label with “ Erratica Plötz i l. ” in Weymer’s handwriting, meaning that this name was given to Weymer by Plötz before publication of the name (therefore “ i. l. ”, for “ in litteris ”). Fourth, Godman (1907), who inspected Plötz original drawing of H. erratica (t [afel]. 656), identified it as male “ Atrytone zabulon ” in accord with the identity of the syntype. We were not able to find other syntypes, and to stabilize nomenclature, N. V. G. hereby designates the sole syntype in the MFNB collection, a male with the following seven printed (but 2 nd, 3 rd, and 4 th and. Art], [Erratica Plötz i l. | taf. 656. Guatemala], [Erratica Pltz | i. l. | Guatemala], [Coll. Weymer], [{QR Code} http: // coll. mfn-berlin. de / u / | 44 a 0 bc], and [DNA sample ID: | NVG- 18052 B 03 | c / o Nick V. Grishin] as the lectotype of Hesperia erratica Plötz, 1883. The last two lines on the 2 nd label are abbreviated and should read “ no 92 bestimmt von Plötz | ist möglicherweise andere Art ”, which we translate as “ no 92 identified by Plötz | is possibly a different species ”, an indication that Plötz would change his opinion about the determination of this specimen as “ zabulon. ” The COI barcode sequence of H. erratica lectotype, sample NVG- 18052 B 03, GenBank OR 837740, 658 base pairs, is: AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACTTCTCTTAGATTACTAATTCGAACTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTCTTATACTAGGAGCTCCTGATATAGCATTTCCACGAA TAAATAACATAAGATTTTGATTATTACCTCCATCATTAACATTATTAATTTCAAGAAGAATTGTCGAAAATGGTGCTGGTACTGGATGAACAGTTTACCCCCCTTTATCAGCAAATATTGC TCACCAAGGTTCTTCCGTAGATTTAGCAATCTTTTCTTTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCT TTTGATCAAATACCATTATTTATTTGAGCTGTAGGAATTACAGCATTATTATTACTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACAT CTTTCTTTGACCCAGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT as a junior subjective synonym of Lon zabulon (Boisduval & Le Conte, [1837]) Genomic tree of specimens identified as Lon zabulon (Boisduval & Le Conte, [1837]) (type locality in North America, possibly USA: Georgia) reveals that the lectotype of Hesperia erratica Plötz, 1883 (type locality in Guatemala, sequenced as NVG- 18052 B 03, Fig. 50 a) is in the clade with specimens from the USA (Fig. 51 violet) and not with specimens from Mexico and Central America, including El Salvador and Costa Rica (Fig. 51 blue, a species different from L. zabulon, see below). Therefore, we confirm H. erratica as a junior subjective synonym of L. zabulon but propose that its type locality given as ‘ Guatemala’ in the original description and on the lectotype labels was erroneous and should be corrected to the USA. Sequencing of L. zabulon specimens across the range will allow us to determine the type locality more precisely. Even from the wing patterns of the lectotype, as also hinted in the original description of H. erratica, it is more likely to be from the United States than Guatemala. First, orange-yellow on the dorsal forewing is more extensive than in Central American specimens, i. e., the triplet of subapical spots is connected to the doublet of submarginal spots (Fig. 50 a), while in Central American specimens, they are typically well-separated from each other (Fig. 50 b). This character is also described for H. erratica by Plötz (1883) as a “ long spot in cells 4 and 5 ”, meaning that there is a yellow background (i. e., “ upperside dark-yellow ”) that is formed by subapical and submarginal yellow spots together with the rest of the wing (except the marginal brown border) and there is a separate brown spot on this background. Instead, specimens from Central America would be described as having 3 yellow subapical and 2 submarginal spots on a brown background by the apex. Second, the ventral hindwing brown border by the outer margin is described by Plötz as “ narrow uneven ” (Fig. 50 a), which is more typical for specimens from the US. This border is usually broader and more even in Central American specimens (Fig. 50 b). Looking more into the discrepancy about the type locality, we find that only two species of Hesperiidae proposed by Plötz have the type locality listed as “ Guatemala. ” In addition to H. erratica, the second one is Achlyodes gorgona Plötz, 1884, a junior subjective synonym of Gesta invisus (Butler & H. Druce, 1872). A possible syntype of A. gorgona is from the Möschler collection (now in MFNB). It was collected in Guatemala in 1884 according to its dedicated locality / collector / date green label, which is likely correct. The type (s) of H. erratica would have been from an earlier collection event because the name was published in 1883. Moreover, unlike A. gorgona, it lacks a dedicated locality label. Therefore, it is unclear whether the type locality in Guatemala is accurate for H. erratica. Localities for the specimens collected in the US were known to be incorrect or missing. At least two mistakes have been documented. First, Goniloba parumpunctata Herrich-Schäffer, 1869 (type locality not stated in the original description, but later assumed to be in South America, possibly Venezuela), which is a junior subjective synonym of Lerema accius (J. E. Smith, 1797) (type locality in USA: Georgia) had the locality of the lectotype (male) and at least one female paralectotype deduced to be in eastern US by genomic sequence comparison (Zhang et al. 2023 a). Second, Pyrgus argina Plötz, 1884 (type locality given as “ Brisbane ” [Australia]), which is a junior subjective synonym of Amblyscirtes hegon (Scudder, 1863) (type locality in USA: New Hampshire, White Mountains), is only known from the USA (Evans 1949). http: // zoobank. org / AA 859 D 18 - CFC 6 - 47 F 8 - 9032 - AB 5 B 6 D 79 EB 69 (Figs. 50 b, 51 part, 52)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025C8C11FE81FCC3FDC3FCA7.taxon	diagnosis	Definition and diagnosis. Genomic trees of specimens identified as Lon zabulon (Boisduval & Le Conte, [1837]) (type locality in North America, possibly USA: Georgia) reveal their partitioning into three clades: from the USA, which is L. zabulon in accord with its phenotype and the type locality, and two others that do not have names (Fig. 51). One of these clades consists of specimens from Mexico and Central America (Fig. 51 blue) and differs from L. zabulon by Fst / Gmin / COI barcode of 0.49 / 0.01 / 3 % (20 bp) thus representing a new species. This species differs from L. zabulon in reduced orange-yellow areas on wings, e. g., broader brown borders and a smaller, disconnected triplet of subapical spots and a doublet of submarginal spots on forewing; ventral hindwing with broader and more even outer border and larger spots (Fig. 50 b); the process of aedeagus is more robust (Fig. 52 a, e – j). Definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly 596.8.5: A 189 G, aly 596.8.5: A 192 T, aly 806.32.1: T 876 C, aly 806.32.1: A 1101 G, aly 1097.21.1: G 46 A and in COI barcode: T 82 C, G 101 A, T 292 C, C 376 T, T 457 C, T 478 C. Barcode sequence of the holotype. Sample NVG- 18115 B 03, GenBank OR 837741, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGTACAGAATTAGGTAACCCTGGATCTTTAATTGGGAATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCTGATATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGAATATTACCCCCCTCACTAACATTATTAATCTCAAGAAGAATTGTAGAAAACGGTGCAGGAACAGGTTGAACTGTTTACCCCCCCTTATCATCTAATATTGC TCATCAAGGATCTTCAGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATCATTAATATACGAATTAAAAACTTAATG TTTGATCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCTTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAACACTT CATTTTTTGATCCAGCAGGGGGAGGAGATCCAATTTTATATCAACACTTATTC	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025C8C11FE81FCC3FDC3FCA7.taxon	materials_examined	Type material. Holotype: ♂ deposited the National Museum of Natural History, Washington, DC, USA Taxco, IX- 14 - 82 | 1850 – 1900 m], [J. A. Powell | J. A. Chemsak | collectors], [Poanes zabulon | (Boisduval & Le Conte) | ♂ | det. J. M. Burns 1992], [DNA sample ID: | NVG- 18115 B 03 | c / o Nick V. Grishin], [USNMENT | {QR Code} | 01531551], and one red [HOLOTYPE ♂ | Lon co | Grishin]. Paratypes: 8 ♂♂: Mexico: 1 ♂ Tamaulipas, 11 km NW Gomez Farias, 6 km W Rancho Cielo, el. 5200 - 5500 ft, 9 - Jul- 1965, genitalia vial NVG 231115 - 03 (NVG- 22056 F 05) [TMMC]; 1 ♂ Veracruz, 10 km W Coscomatepec, el. 1800 m, 12 - Aug- 1987, Brown & Powell leg, genitalia vial J. M. Burns X- 2953 (NVG- 19068 D 12, USNMENT 01559668) [USNM]; 1 ♂ Puebla, 6 mi N Chapulco, el. 7000 ', 4 - Oct- 1975, J. Powell, T. Eichlin & T. Friedlander leg. (NVG- 18115 B 02, USNMENT 01531550) [USNM]; Oaxaca, 5 - 10 mi N of Oaxaca, el. 6000 - 7000 ft, J. Kemner leg.: 1 ♂ 22 - Aug- 1992 (NVG- 18115 B 04, USNMENT 01531552) [USNM] and 1 ♂ 30 - Aug- 1989, genitalia vial NVG 231115 - 02 (NVG- 22056 E 08) [TMMC]; 1 ♂ Chiapas, 12 km S of Las Casas, 26 - 28 - Mar- 1959, T. C. Emmel leg. (NVG- 18115 B 05, USNMENT 01531553) [USNM]; 1 ♂ El Salvador, 2 mi down from Cerro Verde summit, 20 - Aug- 1972, C. F. & S. Hevel leg. (NVG- 18115 B 06, USNMENT 01531554) [USNM]; 1 ♂ Costa Rica, Puntarenas Prov., Monteverde, el. 1300 m, 18 - May- 1985, J. A. Chemsak leg. (NVG- 18115 B 07, USNMENT 01531555) [USNM]. Type locality. Mexico: Guerrero, 5 – 7 km NW of Taxco.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025C8C11FE81FCC3FDC3FCA7.taxon	etymology	Etymology. The name is the last syllable of the country name of the type locality: [Mexi] co. The name is a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3025C8C11FE81FCC3FDC3FCA7.taxon	distribution	Distribution. Mexico to Costa Rica.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302408C16FDB2FCC3FC10FF56.taxon	diagnosis	Definition and diagnosis. Genomic trees of specimens identified as Lon zabulon (Boisduval & Le Conte, [1837]) (type locality in North America, possibly USA: Georgia) reveal their partitioning into three clades: from the USA, which is L. zabulon in accord with its phenotype and the type locality, and two others that do not have names (Fig. 51). One of these clades (Fig. 51 blue) is described as a new species above. The second clade consists of specimens from Panama (Fig. 51 red) and differs from L. zabulon by Fst / Gmin / COI barcode of 0.50 / 0.009 / 2.3 % (15 bp) and from L. co sp. n. by 0.47 / 0.008 / 3.2 % (21 bp), thus representing a new species. This species differs from L. zabulon in being brighter colored and more orange; the orange-yellow patch on dorsal hindwing smaller, more like a patch than the entire hindwing being orange with brown borders, brown border wider; beneath brown spots larger; and from L. co sp. n. in more extensive orange-yellow areas on the forewing, e. g., submarginal and subapical forewing spots larger, on ventral side subapical triplet of spots more orange, like submarginal doublet, not yellower than it; and the absence of pale ray along dorsal hindwing 1 b vein that is usually expressed in L. co sp. n. and L. zabulon. Definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly 525.115.3: G 328 A, aly 2336.10.2: C 108 T, aly 2336.10.2: G 116 A, aly 923. 19.4: T 246 G, aly 923.19.4: C 393 T and in COI barcode: T 79 C, T 169 C, T 206 C, A 349 G, A 577 G. Barcode sequence of the holotype. Sample NVG- 18115 B 09, GenBank OR 837742, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGTACAGAATTAGGCAATCCTGGATCTTTAATCGGAGATGATCAAATTTATAACACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTACCACTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGTTTTTGAATATTACCCCCTTCACTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTACCCCCCCTTGTCATCTAATATTGC TCATCAAGGATCCTCAGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTAATG TTTGACCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCTTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATGTTACTTACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACACTTATTC	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302408C16FDB2FCC3FC10FF56.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Washington, DC, USA [USNM], illustrated in Fig. 50 c, bears four printed (date handwritten) labels: three white [PANAMA: Chiriqui | Volcan Baru 1800 m | 5 Dec. ' 76 | leg. S. S. Nicolay], [DNA sample ID: | NVG- 18115 B 09 | c / o Nick V. Grishin], [USNMENT | {QR Code} | 01531557], and one red [HOLOTYPE ♂ | Lon ma | Grishin]. Paratype: 1 ♂ Panama, Chiriqui, Volcan Baru, el. 1759 m, GPS 8.683, − 82.500, 14 - Feb- 1981, G. B. Small leg. (NVG- 18115 B 08, USNMENT 01531556) [USNM]. Type locality. Panama: Chiriquí, Volcán Barú, elevation ca. 1800 m. a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302408C16FDB2FCC3FC10FF56.taxon	distribution	Distribution. Currently known only from Chiriquí, Panama.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302478C14FED0FEB3FD47FEAE.taxon	description	Furthermore, we found two specimens of interest in MFNB. The first specimen (NVG- 21116 G 04), from the Möschler collection collected in Mexico in 1876 and identified by Möschler as “ vitellina ”, agrees with all characters of this taxon presented above, except that the three spots on the dorsal hindwing are barely visible. This specimen cannot be a syntype because it was collected after the description of C. vitellina. The second specimen (NVG- 22091 C 05) is from Herrich-Schäffer’s collection, also from Mexico, and bears the identification label “ marmorosa HS ” in Herrich-Schäffer’s handwriting. This specimen is one of those Godman (1900) mentioned within his treatment of “ Atrytone melane ” and identified as such. It is probably not a syntype of C. vitellina either because it possesses four (or even five), and not three, as per the original description, yellow spots on the dorsal hindwing. This is a boldly patterned specimen with a very wide ventral hindwing orange-yellow band occupying nearly a third of the wing area, and it is possible that Herrich-Schäffer viewed it as a new species that he planned to call “ marmorosa ”, a name that was never published. Nevertheless, both specimens (NVG- 21116 G 04 and NVG- 22091 C 05) fall within the current concept of “ Paratrytone melane vitellina ” as outlined by Evans (1955) and have not been questioned since (Mielke 2005). Not finding syntypes, we proceeded with the neotype designation because there was an exceptional need to clarify both the taxonomic identity and the type locality of C. vitellina. Although the name has been consistently applied to the Mexican subspecies of L. melane, the potential for destabilization of nomenclature arises due to the existence of additional species in this group in Mexico and Central America (see below) unless the name C. vitellina is objectively defined by the neotype that also provides details about the type locality. A number of Hesperiidae species from Mexico described in the second half of the 19 th century were likely based on specimens from Oaxaca, possibly collected by Deppe in 1824 – 1829. Therefore, we selected a neotype from Oaxaca. Hereby, N. V. G. designates a specimen in USNM illustrated in Fig. 53 (DNA sample NVG- 18115 F 05) as the neotype of Cobalus vitellina Herrich-Schäffer, 1869. This neotype corroborates the current application of the name for a relative of L. melane from Mexico, as stated by Plötz (1883) and Godman (1907), supported by Evans (1955), and followed since in all literature (Mielke 2005). This neotype satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of Cobalus vitellina Herrich-Schäffer, 1869, which is necessary because additional species are present among its close relatives, and to define the type locality that was not stated in the original description; 75.3.2. The characters to differentiate this taxon from others were given in the original description (Herrich-Schäffer 1869), further elaborated by Plötz (1883). We regard them as follows: forewing brown with orange yellow spots in cells R 3 - R 4, R 4 - R 5, R 5 - M 1, M 3 - CuA 1, CuA 1 - CuA 2, and CuA 2 - 1 A + 2 A, and a dot in cell M 2 - M 3, discal cell unmarked; forewing beneath with nearly black basal half; hindwing above brown with three yellow spots in cells M 1 - M 2, M 2 - M 3, and M 3 - CuA 1; hindwing beneath rust-colored with a continuous orange-yellow band; antenna about half of the forewing in length; 75.3.3. The neotype specimen is a male bearing three labels: [MEXICO: OAXACA | c. 3 mi. E La | Trinidad, 8500 ft | 3 - VIII- 1992 | J. Kemner], [DNA sample ID: | NVG- 18115 F 05 | c / o Nick V. Grishin], [USNMENT | {QR Code} | 01531599] and illustrated in Fig. 53; the neotype has a tear along SC vein from costa on the right forewing; 75.3.4. We carefully searched for syntypes of C. vitellina in the MFNB collection (see above) because most of the Herrich-Schäffer Hesperiidae types are in this collection, and a study by Häuser et al. (2003) did not locate the syntypes in Stuttgart. We also checked the ANSP collection, where several Herrich-Schäffer types of Caribbean taxa are curated. We failed to find syntypes of C. vitellina among Hesperiidae holdings in these collections and, therefore, believe that they were lost; 75.3.5. The neotype closely agrees with the original description of C. vitellina in all characters, as evidenced by comparing the neotype illustrated in Fig. 53 with the characters for this taxon given in the original description (Herrich-Schäffer 1869) and listed above (75.3.2.); 75.3.6. The neotype is from Mexico: Oaxaca, ca. 3 mi E of La Trinidad, 8500 ft, and the type locality was not specified in the original description but was stated as “ Mexico ” by Plötz (1883); 75.3.7. The neotype is in C. vitellina neotype, sample NVG- 18115 F 05, GenBank OR 837743, 658 base pairs, is: AACCTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCCTTAAGATTACTAATTCGTACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAACACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATCGGAGGATTTGGAAATTGATTAGTCCCATTAATATTAGGTGCCCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGTTTTTGAATATTACCCCCCTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTACCCCCCCTTATCATCTAATATTGC ACACCAAGGCTCTTCTGTTGATTTAGCAATTTTTTCACTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAAAAATTTAATG TTTGATCAAATACCTTTATTCGTATGATCTGTAGGTATTACAGCCTTATTATTACTTTTATCTTTGCCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302458C15FE0BFAF8FBC8FB06.taxon	description	(Figs. 54 part, 55)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302458C15FE0BFAF8FBC8FB06.taxon	diagnosis	Definition and diagnosis. Genomic sequencing of the two specimens from Baja California Sur, Mexico, identified as a possible subspecies or a distinct geographical segregate of “ Paratrytone melane ” in previous works (Powell 1958; MacNeill 1962; Brown et al. 1992) reveals that they are indeed closely related to Lon melane (W. H. Edwards, 1869) (type locality in USA: California, likely San Francisco Bay area) (Fig. 54): e. g., their COI barcodes differ by 0.3 – 0.6 % (2 – 4 bp), and, therefore, we consider them to be conspecific with it. However, the BCS specimens differ from the nominotypical L. melane in reduced fulvous overscaling at wing bases above, smaller orange spots on the forewing, more diffuse and brownish instead of orange dorsal hindwing spots, and weakly spotted more uniformly colored ventral hindwing. Therefore, they represent a distinct subspecies, which is new. A more detailed description of this subspecies was given by MacNeill (1962: 110 – 111), who called it “ Paratrytone melane subsp. ” without proposing a formal name. Definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly 770.31.1: A 393 C, aly 3721.1.4: G 45 A, aly 93.14. 4: C 408 T, aly 322.23.3: A 87 G, aly 65.5.1: T 199 C and in COI barcode: T 56 C, T 379 A, T 418 C, T 530 C, C 646 C. Barcode sequence of the holotype. Sample NVG- 22101 H 10, GenBank OR 837744, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCCTTAAGACTATTAATTCGTACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCATTAATATTAGGTGCCCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGTTTTTGAATACTACCCCCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTACCCCCCTTTATCATCTAATATTGC TCATCAAGGCTCTTCAGTTGATTTAGCAATCTTTTCACTTCATTTAGCTGGAATCTCATCTATTTTAGGAGCTATTAACTTTATTACAACAATTATCAATATACGAATTAAAAATTTAATG TTTGATCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCCCTATTATTACTTTTATCTTTACCCGTTTTAGCTGGAGCTATTACTATATTACTTACCGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302458C15FE0BFAF8FBC8FB06.taxon	materials_examined	Type material. Holotype: ♂ deposited in the California Academy of Sciences, San Francisco, CA, USA [CAS], illustrated in Fig. 55, bears eight labels: seven white [La Laguna, | Sierra Laguna, | L. Cal. X- 14 - 41], [melane Edw. | Det. by | F H Rindge], [Ross & Bohart | Collectors], [♂], [melane subspecies], [DNA sample ID: | NVG- 22101 H 10 | c / o Nick V. Grishin], [{QR Code} CASENT | 8566940], and one red [HOLOTYPE ♂ | Lon melane | sur Grishin]. Paratype: 1 ♂ same data as the holotype (NVG- 22101 H 09, CASENT 8566939). Type locality. Mexico: Baja California Sur, Sierra de La Laguna.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302458C15FE0BFAF8FBC8FB06.taxon	etymology	Etymology. The name, a masculine noun in apposition, is the last word in the type locality state name, also meaning that this is the southernmost subspecies of L. melane.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302458C15FE0BFAF8FBC8FB06.taxon	distribution	Distribution. Mountains of the Cape region in Baja California Sur, Mexico.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302448C1AFDBBFB66FBF0FB32.taxon	description	(Figs. 54 part, 56)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302448C1AFDBBFB66FBF0FB32.taxon	diagnosis	Definition and diagnosis. The genomic tree reveals that specimens identified as Lon poa (Evans, 1955) (type locality Costa Rica: Mount Poás), stat. nov. partition into two clades (Fig. 54). One clade includes specimens from Costa Rica and Panama, being the true L. poa by locality and phenotype. The other clade is genetically differentiated from the first one with Fst / Gmin / COI barcode difference of 0.41 / 0.004 / 0.9 % (6 bp) and represents a new species. This species keys to “ Paratrytone melane poa ” M. 23.1 (c) in Evans (1955) and is distinguished from the true L. poa by less extensive yellow overscaling on the ventral side of wings, in particular, on the hindwing; this overscaling is whiter, and the ground color in redder and browner than yellower. As a result, there is less contrast between the darker inner half and subapical half of the ventral forewing, which is paler in the apical half and contrasting dark brown towards the inner margin in L. poa. Definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly 3177.11.6: A 36 C, aly 3177.11.6: A 39 G, aly 128.24.1: C 189 T, aly 128.24.1: A 235 C, aly 318.14.6: G 672 A and in COI barcode: T 4 C, T 346 C, T 505 C, A 550 A, 586 T. Barcode sequence of the holotype. Sample NVG- 22105 H 05, GenBank OR 837745, 658 base pairs: AACCTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCCTTAAGATTATTAATTCGTACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAACACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATCGGAGGATTTGGAAATTGATTAGTCCCATTAATATTAGGTGCCCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGTTTTTGAATATTACCCCCCTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTACCCCCCCTTATCATCTAATATTGC ACACCAAGGCTCTTCTGTTGATTTAGCAATTTTTTCACTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAAAAATTTAATG TTTGATCAAATACCTTTATTCGTATGATCTGTAGGTATTACAGCCTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302448C1AFDBBFB66FBF0FB32.taxon	materials_examined	Type material. Holotype: ♂ deposited in the California Academy of Sciences, San Francisco, CA, USA [CAS], illustrated in Fig. 56, bears five labels, the first two handwritten, others printed: four white [Rancho Belen, Chis. | Mex. IV- 17 - 69 | Robert Wind], [P. m. poa], [DNA sample ID: | NVG- 22105 H 05 | c / o Nick V. Grishin], [{QR Code} CASENT | 8568431], and one red [HOLOTYPE ♂ | Lon chia | Grishin]. Paratypes: 5 ♂♂ 1 ♀: Mexico, Chiapas: 1 ♂ Comitan, Laguna Chamula, el. 7100 ft, 13 - May- 1987, C. J. Durden leg. (NVG- 22056 D 01) [TMMC]; San Cristobal, La Almolonga, ca. 7500 ft: 1 ♂ 3 - May- 1988, J. Kemner leg. (NVG- 18115 F 06, USNMEND 01531600) [USNM]; 1 ♂ 9 - Jul- 1988, C. J. Durden leg. (NVG- 20062 F 09) [TMMC]; 1 ♂ 5 - Jul- 1992, J. Kemner & A. Vasquez leg. (NVG- 18115 F 08) [USNM]; 1 ♂ Guatemala, Quiche department, above Chichicastenango, 11 - Jan- 1990, C. J. Durden leg. (NVG- 22056 C 06) [TMMC]; and 1 ♀ El Salvador, 2 mi down from Cerro Verde summit, 20 - Aug- 1972, G. F. & S. Hevel leg. (NVG- 18115 F 09, USNMENT 01531603) [USNM]. Type locality. Mexico: Chiapas, ca. 20 km S of San Cristóbal, Rancho Belén.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302448C1AFDBBFB66FBF0FB32.taxon	etymology	Etymology. Like poa formed from “ Mt. Poas ”, the name chia is formed from Chiapas, for the type locality of this species. The name is a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A302448C1AFDBBFB66FBF0FB32.taxon	distribution	Distribution. Confirmed from Mexico: Chiapas, Guatemala, and El Salvador.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
D20187A3024B8C1BFE87FAB8FA4FFBA2.taxon	description	Morphologically, Burns (1983) identified the lectotype of L. rupilius as Atrytonopsis edwardsi W. Barnes & McDunnough, 1916 (type locality in USA: Arizona, Pima Co.), therefore, L. rupilius is not a junior subjective synonym of Atrytonopsis ovinia zaovinia Dyar, 1913 (type locality in Mexico: Puebla) — currently a junior subjective synonym of Atrytonopsis ovinia (Hewitson, 1866), (type locality in Nicaragua) — as treated by Evans (1955). Genomic analysis confirms this assessment and places the lectotype as sister to another specimen from Mexico: Jalisco (Fig. 57), thus also confirming the type locality as Mexico: Jalisco, Guadalajara. The two specimens from Jalisco (Fig. 57 red) are genetically differentiated from A. edwardsi specimens collected in the USA: Arizona and Texas and Mexico: Sonora (Fig. 57 blue), forming a separate clade. Due to this genetic differentiation, we propose that L. rupilius is a subspecies of Atrytonopsis edwardsi W. Barnes & McDunnough, 1916: Atrytonopsis edwardsi rupilius (Schaus, 1913), comb. nov., stat. nov. Despite a large gap in their distributions, we note that neither COI barcodes nor the whole mitochondrial genomes differentiate these subspecies, and we also see mitochondrial introgression from A. ovinia to A. edwardsi (Fig. 57 b, red and violet within the blue clade).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2023): Genomic analysis reveals new species and subspecies of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (6): 1-63
