Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016
Figs 2A, B, 3A, 4A, 5, 9, 10A, 11, 12
Terebellides shetlandica Parapar, Moreira & O’Reilly, 2016a: 211-225, figs 1-9, 11.
Terebellides shetlandica Species 1 - Nygren et al. 2018: 18-22, figs 6, 10.
Material examined.
30 specimens (Suppl. material 1), Skagerrak (GNM14640); Swedish coast (ZMBN116171, ZMBN116181, ZMBN116185, ZMBN116186, ZMBN116187, ZMBN116188, ZMBN116191, ZMBN116192, ZMBN116193, ZMBN116196, ZMBN116198, ZMBN116200, ZMBN116201, ZMBN116202, ZMBN116203, ZMBN116204, ZMBN116206); Norwegian coast (ZMBN116207, ZMBN116208, ZMBN116214, ZMBN116216, ZMBN116219, ZMBN116220, ZMBN116221, ZMBN116226, ZMBN116227, ZMBN116228, ZMBN116235, ZMBN116242) .
GenBank accession numbers of material examined (COI).
MG024894, MG024895, MG024896, MG024897, MG024898, MG024899, MG024900, MG024901, MG024902, MG024903, MG024904, MG024905, MG024906, MG024907, MG024908, MG024909, MG024910, MG024911, MG024912, MG024913, MG024914, MG024915, MG024916, MG024917, MG024918, MG024919, MG024920, MG024921, MG024922, MG024923, MG024924, MG024925, MG024926, MG024927, MG024928, MG024929, MG024930, MG024931, MG024932, MG024933, MG024934, MG024935, MG024936, MG024937, MG024938, MG024939, MG024940, MG024941, MG024942, MG024943, MG024944, MG024945, MG024946, MG024947, MG024948, MG024949, MG024950, MG024951, MG024952, MG024953, MG024954, MG024955, MG024956 .
Diagnostic features of studied material.
Complete individuals ranging from 5.0-16.0 mm in length (Fig. 9). Branchial dorsal lobes lamellae provided with well-developed papillary projections and branchial ventral lobes provided with long filaments, ranging from 175.0-225.0 µm in length (Figs 2A, B, 4A, 5A, B). Between 22-26 lamellae on dorsal lobes (Fig. 5A, B). Lateral lappets present on TC 1-4; dorsal projections of thoracic notopodia on TC 2 and TC 3 (Fig. 5B). Geniculate chaetae in TC 5, acutely bent, with poorly marked capitium (Fig. 5C). Ciliated papilla dorsal to thoracic notopodia not observed. From TC 7, neuropodia with one row of type 4 thoracic uncini per torus, with rostrum/capitium length ratio of ~ 2:1 and capitium with a first row of small teeth, followed by several smaller teeth (Fig. 5D). Abdomen with 25-34 pairs of neuropodia with type 2 uncini (Fig. 5E, F). Copepods attached to body surface in three specimens (Fig. 5B).
Colour pattern.
MG staining pattern characterised by compact green colourant in SG 1-6, then turning into striped pattern in SG 7-14 and fading in following segments (Fig. 12). Similar to pattern 1.
Nucleotide diagnostic features.
All sequences of Terebellides shetlandica share and are distinguished from other available Terebellides sequences in unique combinations of nucleotides (underlined) at the given position of our alignment: 78-98: CCAACCCGGAGCCTATTTAGGT, 186-192: CGGAAAC, 210-219: GCTAGGCGCC, 228-234: GGCATTC, 264-276: TCTCCCGCCTGCC, 288- 292: CGTT, 306: C, 333-342: CGTCTACCCT, 351-369: AGACAATATGGCACACGCC, 381-402: AGATCTGGCTATTTTCTCCCTA, 453-459: AGTAATA, 511-522: TCAGCTATAATC, 535-558: TTACTTCTTTCTCTGCCAGTTCTG.
Type locality.
NW Hutton Oilfield, between Shetland Islands and Norway, 61°10'N, 01°12'E (Parapar et al. 2016a).
Distribution and bathymetry.
Norwegian coast and shelf, North Sea, Skagerrak, Kattegat; 25-375 m deep; 92.7% of specimens present at depths below 200 m (Figs 10A, 11, Suppl. material 1).
Remarks.
Terebellides shetlandica is a small species, reaching up to 16 mm length and is characterised by having branchiae of type 3 and long filaments in ventral branchial lobes, thoracic uncini of type 4, abdominal uncini of type 2 and lacking papillae on margins of branchial lamellae (Table 1). Parapar et al. (2016a) pointed out that T. atlantis is the most similar species to T. shetlandica; this is confirmed here according to molecular analyses and morphological examination. Both species are small sized (length: T. shetlandica, 5-16 mm; T. atlantis, 10-16 mm) and have branchiae of type 3, with free branchial lobes. However, the branchiae of T. shetlandica have a high number (22-26) of tightly packed branchial lamellae, all lobes are similar in shape and length and ventral ones bear long filaments whereas T. atlantis has a fewer number of branchiae (10-11), lamellae are not packed, lobes differ in shape and size and ventral lobes bear shorter filaments. Furthermore, the range of abdominal chaetigers number is higher in T. shetlandica than in T. atlantis (25-34 vs. 23-28 respectively).