Thecacera pennigera (Montagu, 1815) (Fig. 3)
Doris pennigera Montagu, 1815: 17-18, pl. 4, fig. 5 (cited from Vallés et al., 2000).
Thecacera pennigera: Fleming, 1828: 283 (cited from Willan, 1976); Alder and Hancock, 1855, fam. 1, pl. 21a, figs. 1-9 (cited from Baba, 1960); Willan, 1976: 347-352, fig. 1; Vallés et al., 2000: 26, figs. 7C, 9; Debelius and Kuiter, 2007: 40.
Thecacera maculata Eliot, 1905: 241-243 (cited from Vallés et al., 2000).
Thecacera pennigera var. nigrescens Labbé, 1931: 20 (cited from Willan, 1976).
Thecacera lamellate Barnard, 1933: 294-295, fig. 1 (cited from Vallés et al., 2000).
Material examined. 1 individual, Gangwon-do, Goseong-gun, Jugwang-myeon, Munamjin-ri. 18 Aug 2012 ; 2 individuals (KOSPIV0000157372), Gyeongsangbuk-do, Uljin-gun, Wonnam-myeon, Doeksin-ri. 29 Aug 2012 .
Diagnosis. Body slender (length: 13-17 mm, width: 9-12 mm) with translucent white. Blunte head. Pointed metapodium (Fig. 3A). Dorsum convex and high (Fig. 3B). Rhinophores lamellate with incomplete sheath. Rhinophores surrounded by bifurcate rhinophoral sheath (Fig. 3C). Gills five bipinnate on center of dorsum. Two very long elongated extrabranchial appendages on both sides of gills (Fig. 3D). Numerous yellow and black spots scattered (Fig. 3E, F).
Distribution. Korea, Japan, Parkistan, France, England, Netherlands, Atlantic-USA, South Africa, Angola, Brazil, Australia, New Zealand.
DNA barcode. COI sequences of the first mentioned specimen in the “Material examined” are as follows: 5′- GTGCCTTTTTAGGGGACGATCATTTTTATAATG TTATTGTTACTGCACATGCCTTTGTTATAATTTT TTTCATAGTTATACCAGTAACTATAGGAGGTTT CGGAAATTGAATAATTCCTTTATTAATTGGAGC TCCGGATATGAGTTTTCCTCGAATAAACAACAT AAGATTCTGATTTTTACCTCCTTCATTTGTTTTA CTTTTATGTTCTACTCTCATGGAAGGGGGTGCTG GAACAGGTTGAACTGTTTACCCTCCTTTGTCTG GACCTGTAGGCCATAGGGGTGCTTCTGTGGATC TTGCTATTTTCTCTTTACATCTAGCAGGTGCTTC ATCATTATTGGCTTCAATTAACTTTATTACTACT ATTCTTAATATACGGTCTTCAGCAATAAGTTTC GAGCGGGTGAGGTTGTTTGTATGGTCTCTTTTA GTGACAGCATTCCTTTTACTTCTTTCGTTACCGG TATTAGCAGGTGCTATTACTATATTACTGACA-3′. According to BLAST search to GenBank, this sequence matches 86% with a COI record of Thecacera pennigera (AJ 223277; reported from Spain), single COI record from this species in the GenBank. But, the similarity value shown between two records was not significant indication that two COI records were derived from the same species even though the identification of the species was correct. This means that this species is composed of at least two separate species. Therefore, to prove it more COI records are needed from diverse known localities.
Remarks. Thecacera pennigera is widely distributed worldwide. Willan (1976) suggested that the species spread beyond its original distributional range of distribution by transportation by ship. By examination of present specimens, there was no discrete morphological difference between present specimens and those from other countries except size and number of spots on mantle.