Pellicia (Hemipteris) fumida Mabille, 1889 and Pellicia (Hemipteris) aequatoria Williams & Bell, 1939 are valid species distinct from Pellicia (Hemipteris) tyana Plötz, 1882

We conclude that the specimen in the MFNB collection that bears the following seven labels (1st purple, others white; 2nd to 3rd handwritten, others printed with handwritten text shown in italics): [Origin.], [Itaituba | 86 Hhn.], [hemipteris | fumida Mab. | ♂], [Fumida | Mab.], [GEN.PREP., | MIELKE 1996], [{QR Code} http://coll.mfn-berlin.de/u/ | 940ba3], [DNA sample ID: | NVG-15032F01 | c/o Nick V. Grishin] is the holotype of Hemipteris fumida Mabille, 1889 . It agrees with the original description, and according to its label, the holotype was collected in Brazil: Pará, Itaituba by Hahnel in 1886. The 3rd label is in Mabille’s handwriting. The holotype is an aberrant specimen with hindwings not fully expanded and a poorly developed pattern of spots and bands on the dorsal side of wings, with darker scaling along the veins standing out. Images of the holotype photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The COI barcode sequence of the holotype, sample NVG-15032F01, GenBank PV550038, 658 base pairs, is: AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACATCCTTAAGTTTACTTATTCGATCTGAATTAGGTACTCCTGGTTCTTTAATTGGAGATGATCAAATTTATAACACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATCATAATTGGTGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCTCCTGATATAGCTTTTCCCCGAA TAAATAACATAAGATTTTGACTTTTACCTCCTTCTTTAACTTTATTAATTTCAAGAAGTATTGTAGAAAATGGTGCTGGAACTGGTTGAACTGTTTATCCTCCTTTATCAGCTAATATTGC CCATCAAGGATCCTCTGTTGATTTAGCAATTTTTTCATTACATTTAGCAGGTATTTCCTCTATTTTAGGTGCTATTAATTTTATTACAACTATTATCAATATACGAGTTAATAATTTATTA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCTTTACTTTTATTATTATCATTACCAGTTTTAGCTGGAGCTATTACCATATTATTAACTGATCGTAATTTAAATACAT CTTTTTTCGACCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTC

Genomic analysis of the holotypes of Hemipteris fumida Mabille, 1889 (type locality in Brazil: Pará, Itaituba, sequenced as NVG-15032F01) (Fig. 90 orange) and Pellicia aequatoria Williams & Bell, 1939 (type locality in Ecuador, sequenced as NVG-18024D05) (Fig. 90 pink) currently treated as a junior subjective synonyms of Pellicia (Hemipteris) tyana Plötz, 1882 (type locality in South America, lectotype sequenced as NVG-15032D11) reveals that all three taxa belong to different clades and the former two are not closely associated with any other species. Therefore, we propose that Pellicia (Hemipteris) fumida Mabille, 1889, stat. rest. and Pellicia (Hemipteris) aequatoria Williams & Bell, 1939, stat. rest. are valid species distinct from Pellicia (Hemipteris) tyana Plötz, 1882 .