Pellicia (Hemipteris) cina Grishin, new species

http://zoobank.org/ B301C9F0-F5CA-4B5D-9339-6064F08E7E66

(Figs. 90 part, 92–93)

Definition and diagnosis. Genomic analysis reveals that a specimen from Rondônia, Brazil, identified as Pellicia vecina cyanea Biezanko & O. Mielke, 1973 (type locality Brazil: Rio Grande do Sul, Pelotas), currently treated as a junior subjective synonym of Pellicia vecina Schaus, 1902 (type locality Brazil: Rio de Janeiro, Petropolis, lectotype sequenced as NVG-18061C10), which furthermore (see above) becomes a junior subjective synonym of Pellicia (Hemipteris) tyana Plötz, 1882 (type locality in Brazil, likely São Paulo, lectotype sequenced as NVG-15032D11) due to previous misidentification of P. tyana, is genetically differentiated from and not even monophyletic with P. vecina and Pellicia tyana, and is sister to Pellicia (Hemipteris) naja Steinhauser, 1989, stat. nov. (type locality in Peru: Madre de Dios, holotype sequenced as NVG-15038E08) differing from it at the species level (Fig. 90), and, therefore, this specimen represents a new species. This new species keys to “ Pellicia vecina najaoides ” (E.21.5.(a)) in Evans (1953), which is misspelled, misidentified, and was redescribed by Steinhauser as P. vecina naja, but differs from its relatives by the following combination of characters: dorsal forewing has violet gloss between brown bands, dorsal hindwing is dark-brown with 2 prominent paler bars in the discal cell and paler costal margin, ventral hindwing is brown with paler apex (but not as pale as in P. naja) and paler area along the inner margin, ventral hindwing is brown with paler brown posterior half, paler towards tornus, but not whitish, and with broader than in P. naja dark-brown bands and a prominent dark spot at the tornus; left harpe is armed with prominent teeth on the anterior margin and a sharper, longer tooth directed inwards from the ampulla (Fig. 93). Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly527.12.3:C156T, aly420.21.9:C36T, aly204.15.1:T279C, aly 1113.7.3:T54C, aly 1113.7.3: G78T, however, the COI barcode does not distinguish this species from P. naja .

Barcode sequence of the holotype. Sample NVG-23053D08, GenBank PV550039, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACATCTTTAAGTTTACTTATTCGATCCGAATTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAA TAAATAACATAAGATTTTGACTTTTACCTCCTTCCTTAACTTTATTAATTTCAAGAAGTATCGTAGAAAATGGTGCCGGAACAGGTTGAACTGTATACCCCCCTTTGTCAGCTAATATTGC TCATCAAGGTTCTTCCGTTGATTTAGCAATTTTTTCCTTACACTTAGCAGGTATCTCATCTATTTTAGGAGCTATTAACTTTATTACAACTATTATCAATATACGAGTTAATAATTTATTA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCTTTACTTTTACTATTATCTTTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACTT CCTTTTTTGATCCTGCTGGAGGAGGGGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 92 (genitalia Fig. 93), bears the following six printed (text in italics handwritten) rectangular labels (4 th brownish yellow and the last red): [BRASIL: Rondônia | 62 km S Ariquemes | linea C-20, 7 km E | B-65, Fazenda | Rancho Grande | 14 November 1990 | leg. D&J Lindsley], [Genetalic Vial | GTA- 875], [ Pellicia vecina | cyanea Biezanko & | Mielke | det. GT Austin 199 1], [photographed | G.T. Austin & J. P. Brock | March 1992], [DNA sample ID: | NVG-23053D08 | c/o Nick V. Grishin], and [HOLOTYPE ♂ | Pellicia (Hemipteris) | cina Grishin]. Paratype: 1♂ NVG-24083A08 the same data as the holotype but 7-Nov-1991, G. T. Austin leg., genitalia vial GTA-2138.

Type locality. Brazil: Rondônia, 62 km south of Ariquemes, linha C-20, 7 km east of B-65, Fazenda Rancho Grande .

Etymology. The name is formed from the name of a related taxon, vecina, made shorter for its more northern relative. The name is treated as a feminine noun in apposition.

Distribution. Currently known only from Rondônia, Brazil.