Gorgopas trochicuz Grishin, new species

http://zoobank.org/ DB2C8820-6477-4AF8-B492-4A0E33E7F758 (Figs. 94 part, 95, 96a–c)

Definition and diagnosis. Genomic analysis reveals that two specimens from Cuzco, Peru, identified as Gorgopas trochilus (Hopffer, 1874) (type locality in Bolivia, holotype sequenced as NVG-15032D07) are genetically differentiated from it at the species level in the nuclear genome (Fig. 94), e.g., an Fst value of 0.3, while not differing significantly in the COI barcode (0.3%, 2 bp only), and, therefore, represent a new species. This new species keys to G. trochilus (E.28.1) in Evans (1953) but differs from it by being darker, with a more diffuse pattern of paler spots on both sides of wings and by narrower valvae with a narrower folded-over region at the costa, smaller and less robust sclerotized inner lobes of harpe, in particular on the right valva (Fig. 96a–c)—this lobe is larger and more closely connected with the right harpe in G. trochilus (Fig. 96d–f), which has a broader and rounder right valva, mainly due to a more strongly developed costa with a broader folded-over region. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly383.14.3:G855C, aly383.14.3:G888A, aly1042.34.1:G71A, aly1042.34.1:A167G, aly216.74.1:C48T, and may not confidently differ from G. trochilus in the COI barcode, although the following combination of base pairs identifies sequenced specimens: A34A, A70A, T400T, T595T, 616T.

Barcode sequence of the holotype. Sample NVG-7975, GenBank PV550041, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGATCTGGAATAATTGGAACTTCTTTAAGTATTCTTATTCGATCAGAATTAGGTACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGATTATTACCTCCTTCTCTTATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACTGTTTACCCCCCTCTTTCAGCTAATATTGC TCATCAAGGTTCTTCAGTAGATTTAACTATTTTTTCTCTTCATTTAGCAGGTATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAATTAATAAATTATCA TTTGATCAAATATCTTTATTTATTTGAGGTGTAGGAATTACTGCATTACTTCTATTATTATCTTTACCAGTTTTAGCAGGTGCTATTACTATATTATTAACTGATCGAAATCTTAACACAT CTTTTTTTGATCCTTCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 95 (genitalia Fig. 96a–c), bears the following five printed (text in italics handwritten) rectangular labels, four white: [PERU: Cuzco, 564m. | Pilcopata | Cosnipata Rd 021 | 15-XI-2008 Kinyon], [DNA sample ID: | NVG-7975 | c/o Nick V. Grishin], [genitalia | NVG170207-60 | Nick V. Grishin], [USNMENT | {QR Code} | 01321815], and one red [HOLOTYPE ♂ | Gorgopas | trochicuz Grishin] . Paratype: 1♂ NVG-24065B06 Peru, Cuzco, Pilcopata, 600 m, 15-18-Dec-1979, J. B. Heppner leg. [MGCL] .

Type locality. Peru: Cuzco, Cosñipata Road, Pilcopata, elevation 564 m.

Etymology. The name is a fusion: trochi [lus] + Cuz [co} (for the type locality) and is treated as a noun in apposition.

Distribution. Currently known only from the type locality, which is to the northeast of the Andes in southern Peru.