Gorgopas trochitango Grishin, new species
http://zoobank.org/ DAAE3729-7B65-423B-BD81-052BBB2C6533
(Figs. 94 part, 99–100)
Definition and diagnosis. In addition to the two new species described above, specimens from Argentina are genetically differentiated from Gorgopas trochilus (Hopffer, 1874) (type locality in Bolivia, holotype sequenced as NVG-15032D07) at the species level (Fig. 94); e.g., their Fst /COI barcode differences are 0.51/1.7% (11 bp), and, therefore, represent a new species. This new species keys to G. trochilus (E.28.1) in Evans (1953) but differs from it and the two new species described above by being paler, with a more strongly defined contrast between darker brown and paler brown areas giving the dorsal hindwing a checkered appearance, significantly weaker green overscaling that on the hindwing is nearly vestigial and constrained to the very base, more pointed forewings, broader valvae with a slightly smaller and less distinct sclerotized inner lobe of harpe. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly251.9.2:G45A, aly251.9.2:G57A, aly320.2.32:C36T, aly320.2.32: G48A, aly1139.31.4:G1091T; and COI barcode: C187C, C340T, T382T, T499C, 598A.
Barcode sequence of the holotype. Sample NVG-23055H09, GenBank PV550043, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGATCTGGAATAATTGGAACTTCTTTAAGTATTCTTATTCGATCAGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTCGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGATTATTACCTCCTTCTCTTATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACTGTTTATCCCCCTCTTTCAGCTAATATTGC TCATCAAGGTTCTTCAGTTGATTTAACTATTTTTTCTCTTCATTTAGCAGGTATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAATTAATAAATTATCA TTTGATCAAATATCCTTATTTATTTGAGCTGTAGGAATTACTGCATTACTTCTATTATTATCTTTACCAGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATCTAAATACAT CTTTTTTTGACCCTTCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 99 (genitalia in Fig. 100), bears the following five printed rectangular labels, four white: [Baritú Lodge | Salta, Argentina | S22°37.953’; W64°26.612’ | elevation 2112 ft. | November 17, 2003 | D.L Lindsley], [ Gorgopas Godman&Salvin | tröchilus (Hopffer)], [D.L. Lindsley colln. | MGCL Accession | # 2008-20], [DNA sample ID: | NVG-23055H09 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Gorgopas | trochitango Grishin]. An unnumbered vial with genitalia, likely dissected by D. L. Lindsley, is pinned between the labels of the holotype. Paratypes: 3♂♂ from Argentina, R. Eisele leg. [MGCL]: 2♂♂ NVG-24065B07 and NVG-23055H08 Jujuy, Ledesma, Calilegua, Rt. 83. 5–7.5 km W of Rt. 34, 550- 600 m, 4-Apr-1991 and 1♂ NVG-24065B08 Salta, Sierra de Tartagal, Rio Yacuy, 14 km W of Rt. 34, 800 m, 10-Apr-1975 .
Type locality. Argentina: Salta, Baritú Lodge, elevation 2112 ft, GPS −22.6326, −64.4435.
Etymology. The name is a fusion: trochi [lus] + tango (strongly associated with Argentina, for the type locality) and is treated as a noun in apposition.
Distribution. Currently known only from northern Argentina.