Gomalia westafra Grishin, new species

http://zoobank.org/ 88CD5D4F-C4D4-4D29-8724-D379F4654CC9 (Figs. 104 part, 106a–b, 107a)

Definition and diagnosis. Genomic analysis of Gomalia F. Moore, 1879 (type species Gomalia albofasciata F. Moore, 1879) reveals that specimens from western Africa form a separate clade in the nuclear genome genetically differentiated from others at the species level (Fig. 104); e.g., their COI barcodes differ by about 1.8% (12 bp) from Gomalia elma (Trimen, 1862) (type locality in South Africa), by 1.7% (11 bp) from Gomalia litoralis Swinhoe, 1885 stat. rest. (type locality Pakistan: Karachi) and by 6.2% (41 bp) from Gomalia albofasciata Moore, 1879 (type locality in Sri Lanka), and, therefore, represent a new species. In the mitochondrial genome, the new species forms several separate clades, each containing only specimens of this species. This new species keys to “ Gomalia elma ” (III.A.(b 1)) in (Evans 1937) but differs from it and other relatives by the following combination of characters: tufts of hair-like scales by male genitalia are dark brown; wings are more rounded, darker and less variegated, as especially noticeable on the ventral side; cream hindwing band is narrower and better defined, with darker veins separating it into spots, the spot in the cell CuA 1 -CuA 2 typically overlaps less with the spots between veins M 1 and CuA 1, and stronger sticks out basad from the band; harpe is more robust, with a more convex ventroposterior margin in lateral view; dorsal margin of sacculus is straighter, without a prominent concavity. Due to the partly cryptic nature of this species and poorly explored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly728.34.6:G33A, aly728.34.6:T69C, aly216.22.9:C33T, aly216.22.9: C69T, aly 2661.9.1:C126T; and COI barcode: A43A, 88T, 424T, C483C, T553C, 646T.

Barcode sequence of the holotype. Sample NVG-24066B03, GenBank PV550047, 658 base pairs: AACATTATATTTTATTTTTGGAATCTGATCAGGAATAGTAGGAACATCTTTAAGATTACTTATTCGATCAGAATTAGGAACACCTGGTTCACTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCACATGCTTTCATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCATTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCCCCATCTCTTACTCTCTTAATTTCAAGTAGTATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCTCCTCTCTCAGCTAATATTGC CCACCAAGGATCTTCAGTAGATTTAGCTATCTTTTCCCTTCATTTAGCTGGAATTTCATCTATTTTAGGGGCAATTAATTTTATTACAACAATTATTAATATACGAGTTAATAATTTATCT TTTGATCAAATACCTCTTTTTGTTTGAGCTGTTGGAATTACAGCTTTACTTTTATTATTATCTTTACCCGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 106a, bears the following five printed (text in italics handwritten) rectangular labels (3 rd green, 5 th red, others white) [GHANA | Likpe | 22-xi -196 8 | Fr. Th. Maessen], [A. C. Allyn | Acc. 1969-6], [{QR Code} UF | FLMNH | MGCL 1162140], [DNA sample ID: | NVG-24066B03 | c/o Nick V. Grishin], and [HOLOTYPE ♂ | Gomalia westafra | Grishin]. Paratypes: 4♂♂ and 4♀♀: 1♂ NVG-24066B01, UF FLMNH MGCL 1162125 Côte d'Ivoire, Bouake, 25- Mar-1974, E. Munroe leg. [MGCL]; Ghana, the same data as the holotype except as specified: 1♂ NVG-24066B02, UF FLMNH MGCL 1162130, 6-Jul-1970, genitalia NVG241111-27 (Fig. 107a); 1♀ NVG-24066B04, UF FLMNH MGCL 1162146, 7-May-1980; and 1♀ NVG-24066B05, UF FLMNH MGCL 1162148 Hohoe instead of Likpe, 1-Jul-1956; Nigeria: 1♂ NVG-17092B09, USNMENT 00894593 Oyo State, Ibadan, May-Jun-1951, H. J. Sutton leg. [USNM] and 1♀ NVG-24054B03 Nigeria, Lagos State, Isheri, 5-Oct-1980, H. Kapala leg. [ZMUC]; and West Africa (no detailed locality, old specimens): 1♂ NVG-19046G11, AMNH_ IZC 00346646 [AMNH] and 1♀ NVG- 17069F 08, USNMENT 00894397 [USNM] .

Type locality. Ghana: Oti Region, Likpe.

Etymology. The name is given for the West African distribution of this species and is a feminine noun in apposition.

Distribution. Western Africa, currently known from Côte d'Ivoire, Ghana, and Nigeria.