Chirgus (Chirgus) argentinus Grishin, new species

http://zoobank.org/ 6D8855C3-80A6-4F0F-8461-517F01A8427A

(Figs. 109 part, 110–111)

Definition and diagnosis. A specimen from Argentina initially identified as Chirgus limbata (Erschoff, 1876) (type locality in Peru) (Fig. 109 orange) is genetically differentiated from it at the species level in the nuclear genome (Fig. 109a, b), e.g., the Fst for their comparison is 0.24, and is not monophyletic with it in the mitochondrial genome tree (Fig. 109c), which is riddled with introgression. Therefore, this specimen represents a new species. This new species keys to “ Pyrgus limbata limbata ” (G.1.2.(a)) in Evans (1953) but differs from its relatives by a combination of the following characters: the pale spot in the middle of the dorsal hindwing discal cell is either absent or vestigial and the discal band (sometimes reduced to a central spot) is separated from the paler costal area, which may be vestigial; the ventral hindwing is paler and with a more contrasting dark pattern on it consisting of two bands (sometimes broken into segments or spots) and a basal dark dot, the submarginal area distad of the postdiscal band is only slightly darker than the area between the two bands, without paler dots inside (usually darker in C. limbata, and may be with paler dots between veins); fringes are typically stronger checkered than in C. limbata . Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly525.91.4:A76T, aly525.91. 4:A78T, aly 1196.3.1:C306T, aly 1196.3.1:T327C, aly587.15.1:C265T, aly619.10.5:G90G (not A), aly102.6.2: G543G (not A), aly102.6.2:C549C (not T), aly208.16.7:A24A (not T), aly208.16.7:G48G (not A). In the COI barcode, this species may not differ from some specimens of its relatives due to introgression.

Barcode sequence of the holotype. Sample NVG-15092G11, GenBank PV550049, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCATTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCCTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTCGGGAATTGATTAGTACCATTAATACTAGGAGCTCCAGATATAGCTTTTCCTCGAA TAAATAATATAAGATTTTGATTATTACCTCCTTCATTAACATTACTTATTTCAAGTAGTATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTACCCCCCTCTTTCAGCTAATATTGC CCATCAAGGTTCTTCTGTTGATTTAGCTATTTTCTCTTTACATTTAGCAGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCA TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCCTTACTTCTTTTATTATCATTGCCTGTTTTAGCAGGAGCTATTACAATATTATTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 110 (genitalia Fig. 111), bears the following seven rectangular labels (2 handwritten, others printed), six white: [ARGENTINA Jujuy | (Tumbaya) | Purmamarca to Rt. | 40, Rt 52 km 38, | 4170 m 21-i-88 Leg | R Eisele 88J5], [♂], [MGCL Accession | #2011-4 | Robert Eisele], [DNA sample ID: | NVG-15092G11 | c/o Nick V. Grishin], [DNA sample ID: | NVG-24068C09 | c/o Nick V. Grishin], [genitalia: | NVG241111-32 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Chirgus (Chirgus) | argentinus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratype: 1♀ NVG-24068C 08 Argentina, Jujuy, Tilcara Department, Cerro Sisilera, 15 km SE of Huacalera, 4550 m, 20-Dec-1990, David Greenman leg. [MGCL] .

Type locality. Argentina: Jujuy Province, Tumbaya Department, Purmamarca to Rt. 40, km 38 of Rt. 52, elevation 4170 m.

Etymology. The name refers to the country with the type locality and is treated as a noun in apposition.

Distribution. Argentina.

Comment. Published records of Chirgus limbata from Argentina (Gomariz 2020; Núñez-Bustos 2023) likely refer to this species.