Vacerra tama Grishin, new species
http://zoobank.org/ 4774ED12-2163-4DB9-B8ED-DE65D9247593
(Figs. 134 part, 135–136)
Definition and diagnosis. The nuclear genomic tree of Vacerra Godman, 1900 (type species Hesperia litana Hewitson, 1866) reveals that a specimen from Mexico: Tamaulipas (NVG-22056G03) is a distant sister of Vacerra gayra (Dyar, 1918) (type locality in Mexico: Guerrero) and is strongly differentiated from it genetically (Fig. 134); e.g., their COI barcodes differ by 4.7% (31 bp). Therefore, this specimen represents a new species. This new species is phenotypically similar to V. gayra and keys to “ Vacerra egla gayra ” (O.8.2.(a)) in Evans (1955) but differs from it by a more aligned basal margin of a paler marginal band on the ventral hindwing in cells Sc+R 1 -RS and RS-M 1, so that the brown ground color basad of the band does not protrude more strongly in the cell RS-M 1 than in the cell Sc+R 1 -RS. In V. gayra, the basal margin is stepwise in cells RS-M 1 and Sc+R 1 -RS, so that the brown ground color reaches closer to the wing outer margin in cell RS-M 1 than in cell Sc+R 1 -RS. Due to unexplored individual variation and possibly cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly412.8.5:A210G, aly9588.18.2:G48A, aly 2275.10.11:C135T, aly 2275.10.11:A159C, aly16031.3.3:T46C, aly16031.3.3:G48G (not A), aly318.28.9:T294T (not C), aly318.28.9:G300G (not C), aly925.11.9:C336C (not T), aly925.11.9: T342T (not C); and COI barcode: T46A, A49C, T64C, A199G, T439C, T514C.
Barcode sequence of the holotype. Sample NVG-22056G03, GenBank PV550059, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATACTAGGAACATCCCTAAGACTATTAATCCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTGGTTCCTCTTATATTAGGAGCTCCAGATATAGCTTTTCCACGAA TAAATAATATAAGATTTTGAATATTACCCCCCTCATTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCAGGAACTGGTTGAACTGTATATCCACCTTTATCTTCAAATATTGC CCATCAAGGAGCTTCAGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGTATTTCTTCTATTCTAGGAGCTATCAACTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCT TTTGATAAAATACCTTTATTTGTTTGATCCGTGGGTATTACAGCCTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the collection of the Biodiversity Center, University of Texas at Austin, Austin, TX, USA (TMMC), illustrated in Fig. 135 (genitalia Fig. 136), bears the following five printed rectangular labels, four white: [TA.GomezFarias.017 | 1–3kSSW ElAzteca | DurdenCJ 91145A36], [DNA sample ID: | NVG-22056G03 | c/o Nick V. Grishin], [DNA sample ID: | NVG-24015E06 | c/o Nick V. Grishin], [genitalia: | NVG241114-12 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Vacerra tama | Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. The holotype was collected on 25-May-1991 (i.e., “91145”: day 145 of 1991, A36 is the collection event referring to this specimen in Durden’s master catalog), and 017 after “GomezFarias” on the first label is the code for the locality “1 to 3k SSW El Azteca towards Gomez Farias.” Paratype: 1♂ NVG-24015D04, the same data as the holotype, but 1–4 km N of Gomez Farias, 350 m, 19-Aug-1972 .
Type locality. Mexico: Tamaulipas, Gomez Farias, 1–3 km south-southwest of El Azteca towards Gomez Farias.
Etymology. The first two syllables of the Mexican state name with the type locality of this species are used as the name. The name is treated as a noun in apposition.
Distribution. Currently known only from northeastern Mexico.