Vacerra cuza Grishin, new species

http://zoobank.org/ 5BFDC6C4-DAA3-446D-B9DF-E2BA2D270F56

(Figs. 134 part, 139–140)

Definition and diagnosis. Genomic sequencing of a specimen from Cuzco, Peru, identified as “ Vacerra hermesia cecropterus ” reveals that it is not monophyletic with the lectotype of Vacerra cecropterus (Draudt, 1923), stat. rest. (type locality in Bolivia: Rio Zongo, sequenced as NVG-18093D10) and is instead sister to Vacerra hermesia (Hewitson, 1870) (type locality in Ecuador), being genetically differentiated from them at the species level (Fig. 134); e.g., their COI barcodes differ by 2.0% (13 bp) (from its sister V. hermesia) and 1.5% (10 bp) (from a more distant relative V. cecropterus). Therefore, the Peruvian specimens represent a new species. This new species keys to “ Vacerra hermesia cecropterus ” (O.8.7.(b)) in Evans (1955) but differs from its relatives by a combination of the following characters: green dorsal overscaling typically subdued, does not strongly stand out and is more olivebrown (not prominently blue-green as in V. hermesia); the hyaline spot in the forewing cell CuA 1 -CuA 2 being more rounded and strongly separated from the discal cell spot by a brown ground color area and offset distad from it; a small but prominent cream-colored spot in the discal cell of the ventral hindwing; traces of postdiscal cream-colored spots in ventral hindwing cells CuA 1 -CuA 2 and CuA 2 -1A+2A and at the base of cell Sc+R 1 -RS; and a size comparable to V. cecropterus and smaller than V. hermesia . Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly6841.81.1:T529A, aly6841.81.1:C564T, aly84.83.1:G822A, aly36444.1.1:G117A, aly36444.1.1:C141T, aly1603.41.2:A72A (not C), aly16812.3. 4:C81C (not T), aly16812.3.4:G174G (not T), aly164.16.14:G66G (not C), aly164.16.14:C195C (not T); and COI barcode: T19C, T121C, T250C, T361T, T385C, T436C.

Barcode sequence of the holotype. Sample NVG-18128C01, GenBank PV550061, 658 base pairs: AACTTTATATTTTATTTTCGGTATTTGAGCAGGAATACTAGGAACTTCACTAAGACTTTTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGAGACGATCAAATTTATAATACC ATTGTCACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATCGGAGGATTTGGAAATTGATTAGTTCCTCTTATATTAGGAGCTCCAGATATAGCTTTCCCACGAA TAAATAACATAAGATTTTGAATATTACCCCCATCATTAACATTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCAGGAACCGGTTGAACTGTTTATCCACCTTTATCTTCAAATATTGC CCATCAAGGAGCTTCTGTTGACTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCTTCTATTTTAGGAGCCATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCT TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGTATTACAGCTTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCAATTACCATATTACTCACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ currently deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 139 (genitalia Fig. 140), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [Peru: Cuzco Dept, 1375m | Cosñipata Valley, San Pedro | 13° 03' S, 71° 33' W | November 3, 2017 | Leg: W. Dempwolf], [ Vacerra hermesia | cecropterus | ♂ | Coll of: W R Dempwolf], [DNA sample ID: | NVG-18128C01 | c/o Nick V. Grishin], [DNA sample ID: | NVG-24015G02 | c/o Nick V. Grishin], [genitalia: | NVG241114-46 | c/o Nick V. Grishin], [WRD 14,869], and one red [HOLOTYPE ♂ | Vacerra cuza | Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection.

Type locality. Peru: Cuzco Region, Cosñipata Valley, San Pedro, elevation 1375 m, GPS −13.05, −71.55.

Etymology. The name is formed from the name of the Peruvian region with the type locality and is treated as a feminine noun in apposition.

Distribution. Currently known only from the holotype collected in Cuzco, Peru.