Oligoria (Oligoria) tinalandia Grishin, new species
http://zoobank.org/ DEA84675-0EF3-454E-A754-C848A69F0F63
(Figs. 141 part, 142)
Definition and diagnosis. A specimen from the western slopes of the Andes in northern Ecuador is sister to Oligoria (Oligoria) rindgei (H. Freeman, 1969) (type locality in Mexico: Oaxaca), but is genetically differentiated from it at the species level (Fig. 141); e.g., their COI barcodes differ by 3.6% (24 bp), and, therefore, represents a new species. This new species keys to “ Decinea percosius ” (L.11.7) in Evans (1955) and, while being most similar to its sister O. rindgei, differs from it and other relatives by the following combination of characters in females: hyaline spots are larger than in O. rindgei, three forewing subapical spots are increasing in length from the costal margin, more rectangular (less rounded) spots in cells M 3 -CuA 1 and CuA 1 -CuA 2, two pale spots on both sides of the hindwing, the anterior spot is semi-hyaline and larger than the posterior one, a small pale spot at the end of the discal cell on the ventral hindwing, other pale markings are less developed than O. rindgei, tornal cream-colored area on ventral forewing is less developed, more overscaled with brown in the anterior part of the cell CuA 2 -1A+2A, discal cell cream spot on ventral hindwing is less developed, ventral hindwing is with paler submarginal overscaling from the tornus to the CuA 2 vein. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly522.8.3:G69A, aly 1041.8.1:C42A, aly2178.47.6:G90A, aly168.10.2:G207A, aly3936.4.11:C24G, aly1080.19.1:G111G (not A), aly 1468.7.9:T72T (not C), aly525. 127.2:G277G (not A), aly84.86.1:A81A (not T), aly37338.52.1:A45A (not C); and COI barcode: T22C, A100G, T163T (not C), T367C, T403C, T571C.
Barcode sequence of the holotype. Sample NVG-24065F10, GenBank PV550062, 658 base pairs: AACTTTATATTTTATTTTTGGCATTTGAGCAGGAATATTAGGAACTTCCTTAAGATTATTAATTCGAACAGAATTAGGTAATCCAGGATCATTAATTGGGAATGACCAAATTTATAATACT ATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAA TAAATAATATAAGATTTTGAATATTACCTCCTTCTTTAATTCTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACTGGTTGAACAGTTTATCCCCCTTTATCTTCTAATATTGC CCACCAAGGATCCTCTGTTGATTTAGCAATTTTTTCTCTCCATTTAGCTGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCA TTTGATCAAATACCTTTATTTGTATGATCTGTAGGTATTACTGCTTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATCACTATATTACTTACTGATCGAAATCTTAATACTT CATTTTTTGATCCAGCAGGAGGAGGGGATCCAATTTTATACCAACATTTATTT
Type material. Holotype: ♀ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 142, bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ECUADOR | Pichincha Province | Hotel Tinalandia | 12 km E Santa | Domingo de los | Colorados | 750–850 m | 11 May 1988 | leg C&A Austin], [Allyn Museum Photo | No. 901017A-17,18], [Genitalia Vial | SRS- 3829], [ Decinea percosius ? | (Godman) ♀ | det. S. R. Steinhauser], [G.T. Austin colln. | MGCL Accession | #2004-5], [DNA sample ID: | NVG- 24065F 10 | c/o Nick V. Grishin], and one red [HOLOTYPE ♀ | Oligoria (Oligoria) | tinalandia Grishin]. Genitalia vial was not located in the collection, but a vial with genitalia from a different specimen was pinned next to the holotype .
Type locality. Ecuador: Santo Domingo de los Tsáchilas Province, 12 km east of Santo Domingo de los Tsáchilas, Tinalandia Lodge, elevation 750–850 m.
Etymology. The name is given for the type locality and is a feminine noun in apposition.
Distribution. Currently known only from the holotype collected in the western Andes of Northern Ecuador.