Damas kenos Grishin, new species

http://zoobank.org/ F274D8A9-4E44-4704-84BF-C1AAF9939812 (Figs. 148d, 149j–k, 152 part, 153 part)

Definition and diagnosis. Several specimens from the Amazonian region are genetically differentiated from other Damas Godman, 1901 (type species Goniloba clavus Herrich-Schäffer, 1869) at the species level, forming a separate clade sister to several other species in the genus (Fig. 152 orange) and, therefore, represent a new species. This new species keys to Damas clavus (K.26) in Evans (1955) but differs from all its congeners by the combination of the following characters in males: the lack (or a trace) of the discal cell spot on the forewing, narrower brand (with the 3 rd small dot-shaped segment in the middle of the cell CuA 2 -1A+2A, only slightly longer (along the CuA 2 vein) than wide brand segment below the CuA 2 vein, nearly triangular semi-hyaline spot in cell CuA 1 -CuA 2 with only slightly concave outer margin; dark ventral hindwing with little purple gloss, only slightly paler area towards the inner margin of dorsal forewing with a diffuse cream spot (smaller than the spot in the cell CuA 1 -CuA 2) in the middle of the cell CuA 2 -1A+2A, more extensive on the underside; one small subapical spot; head brownish-gray, including ventral side of the palpi and cheeks. Due to the somewhat cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly318.43.4:A87G, aly318.43.4:T117C, aly686.10.2:T42G, aly686.10.2:A63G, aly4740.1.1:C969T; and COI barcode: A79G, T82C, T106C, A331G, T428C.

Barcode sequence of the holotype. Sample NVG-23078E10, GenBank PV550071, 658 base pairs: AACTTTATATTTTATTTTTGGTGTATGAGCAGGATTATTAGGAACTTCCTTAAGTATACTAATTCGAACAGAATTAGGGAACCCTGGATCTTTAATTGGAGATGACCAAATTTATAATACA ATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGTGCTCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGATTTTGGATACTACCCCCATCCTTAATCTTATTAATTTCAAGAAGAATCGTAGAAACTGGAGCAGGAACTGGTTGGACTGTTTACCCCCCTCTTTCCTCCAATATTGC CCACCAAGGAGCTTCAGTAGATTTAGCTATTTTTTCTCTACATTTAGCAGGAATTTCTTCTATTCTAGGAGCAATCAATTTTATTACTACAATCATTAATATACGAGTAAGAAACTTATCC TTTGATCAAATACCATTATTTATTTGATCAGTAGGAATTACAGCTCTTTTATTACTTTTATCTTTACCAGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAACCTTAATACTT CTTTTTTTGATCCAGCTGGTGGAGGAGATCCTATTTTATACCAACATTTATTT

Type material. Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 148d, bears the following four printed rectangular labels, three white: [Iquitos | Amazon. Sup. | 1892. Michael], [Coll. Staudinger], [DNA sample ID: | NVG-23078E10 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Damas kenos | Grishin]. The holotype was collected in 1892 by Otto Michael. Paratypes: 4♂♂ and 1♀: Peru, Madre de Dios, Tambopata Reserve: 1♂ NVG-23123B06 Rio la Torre, 1-Oct-1986. S. S. Nicolay leg., genitalia NVG240817 -70 (Fig. 149j, k) [USNM] and 1♀ NVG-24099C08 60 km S of Puerto Maldonado, Rio Tambopata, 25-Oct-1999, D. & J. Lindsley leg. [MGCL] and Brazil, Pará: 1♂ NVG-24099D08 Santarem, ex coll. Le Moult; 1♂ NVG-21118A09 1886, Donckier leg. [MFNB] and 1♂ NVG-18056H09 " Amaz. Inf. " P. Hahnel leg. [ZSMC] . The last specimen is labeled as a “ paratype ” of Proteides ampyx Mabille, 1891 (type locality in Panama: Chiriquí). However, it is not from the type locality and, therefore, is not a syntype of that taxon.

Type locality. Peru: Loreto Region, Iquitos .

Etymology. In Greek, κενός (kenos) means empty or void and is given for the lack of a pale spot in the discal cell of the forewing in this species. The name is treated as an indeclinable adjective.

Distribution. The Amazonian region from north-eastern Peru to the lower Amazon.