Lasaia cola Grishin, new species
http://zoobank.org/ 83817CD8-BC22-4AA1-BF5C-7F07CA4DF9D7 (Figs. 6 part, 7, 8b)
Definition and diagnosis. Nuclear genome analysis of Lasaia H. Bates, 1868 (type species Papilio meris Stoll, 1781) reveals a clade (Fig. 6a red) that is sister to both Lasaia sula Staudinger, 1888 (type locality in Honduras) (Fig. 6 blue) and Lasaia peninsularis Clench, 1972 (type locality in Mexico: Veracruz) (Fig. 6a purple), thus representing a new species. The three species (the new one, L. sula, and L. peninsularis) are genetically differentiated from each other to a similar degree in the nuclear genome (Fig. 6a) (Fst 0.37 and 0.44 between the new one and L. sula and L. peninsularis, respectively) but do not strongly differ in the mitochondrial genome (Fig. 6b) and, consequently, also in the COI barcode. The new species differs from its relatives by males having better developed dark spots and dashes, the hindwing with stronger developed dark dashes, similarly to the forewing (weaker than on the forewing or absent dashes in both L. sula and L. peninsularis), and some specimens having less blue above, greyer, thus somewhat resembling Lasaia maria maria Clench, 1972 (type locality in Mexico: Jalisco) and Lasaia sessilis Schaus, 1890 (type locality in Mexico: Veracruz), but are paler and patterned more like L. sula . In male genitalia (Fig. 8), the transtilla (McAlpine 1971) is pointed in the middle as in L. peninsularis and not flattened as in L. sula (Fig. 8 green arrow 1); lateral lobes of the transtilla are narrower than in L. sula and are more similar to L. peninsularis (Fig. 8 green arrow 2), if not smaller; and the scobinate bulla (Clench 1972) (Fig. 8 green arrow 3) is more robust than in the other two species. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 2812.5.8:A69 T, cne28857.1.4:G42A, cne28857.1.4:A65G, cne8137.3.6:C54 T, cne8137.3.6:C66 T. The COI barcode does not differ for L. sula . Barcode sequence of the holotype. Sample NVG-23103F05, GenBank PV 549979, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACATCATTAAGTTTATTAATTCGTATAGAATTAGGTATACCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCATTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCCCCATCTTTATTTCTATTAATTTCAAGAAGTATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTTTATCCCCCTTTATCTTCTAATATTGC CCACGGAGGATCCTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCCATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCATTATTCGTATGATCCGTTGGTATTACTGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACAT CTTTTTTTGATCCAGCAGGAGGAGGTGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), illustrated in Fig. 7, bears the following four rectangular labels (1 st handwritten, others printed), three white: [MEXICO: Colima | Comala 2100 ft. | 1.X.1967 | R.G.Wind], [R.G. Wind, leg. | Gift of F.M.Brown | C.M. Acc. 23123], [DNA sample ID: | NVG-23111F10 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Lasaia cola | Grishin]. Paratypes: 2♂♂ and 1♀ from Mexico, Colima: 1♂ NVG-24079H06 (leg DNA extraction, sequenced), NVG-25014D03 (abdomen DNA extraction and dissection) La Salada, 1000 ft, 4-Jan-1968, Robert G. Wind leg., genitalia NVG250517 -02 (Fig. 8b) [MGCL] and (no locality details) [SMF]: 1♂ NVG- 23103F 05 May-1918 and 1♀ NVG- 23103F 06 Oct-1926 .
Type locality. Mexico: Colima, Comala, elevation 2100 ft.
Etymology. The name is formed from the type locality in Col [im] a and is a feminine noun in apposition.
Distribution. Currently known only from Colima in Mexico.
Comment. In Lasaia, valvae are partly (and weakly) sclerotized and are flexible, semi-transparent side flaps (with sparse setae) on the sides of the scobinate bulla (Clench 1972), as seen in Fig. 8a, ventral view.